Incidental Mutation 'R4826:Herc6'
List |< first << previous [record 23 of 60] next >> last >|
ID374144
Institutional Source Beutler Lab
Gene Symbol Herc6
Ensembl Gene ENSMUSG00000029798
Gene Namehect domain and RLD 6
SynonymsHerc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57581000-57664632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57647087 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 614 (M614K)
Ref Sequence ENSEMBL: ENSMUSP00000031817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031817]
Predicted Effect probably benign
Transcript: ENSMUST00000031817
AA Change: M614K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: M614K

DomainStartEndE-ValueType
Pfam:RCC1 40 89 1.9e-12 PFAM
Pfam:RCC1 92 142 4.8e-17 PFAM
Pfam:RCC1_2 129 158 3.4e-14 PFAM
Pfam:RCC1 145 195 1.6e-18 PFAM
Pfam:RCC1_2 183 211 1e-8 PFAM
Pfam:RCC1 198 250 2e-10 PFAM
Pfam:RCC1_2 237 266 4e-10 PFAM
Pfam:RCC1 253 301 4.8e-9 PFAM
low complexity region 359 373 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
HECTc 677 1003 1.03e-57 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Herc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Herc6 APN 6 57607145 missense probably benign 0.03
IGL00836:Herc6 APN 6 57619549 missense probably damaging 0.98
IGL01289:Herc6 APN 6 57598623 missense probably damaging 1.00
IGL01631:Herc6 APN 6 57604107 missense probably benign 0.03
IGL02656:Herc6 APN 6 57611836 critical splice donor site probably null
IGL02966:Herc6 APN 6 57583333 critical splice donor site probably null
IGL03297:Herc6 APN 6 57662389 missense probably benign 0.03
IGL02835:Herc6 UTSW 6 57646161 missense possibly damaging 0.94
R0218:Herc6 UTSW 6 57619601 missense probably benign 0.00
R0470:Herc6 UTSW 6 57619452 missense probably damaging 1.00
R0699:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0702:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0707:Herc6 UTSW 6 57662362 missense possibly damaging 0.81
R0850:Herc6 UTSW 6 57583242 missense possibly damaging 0.84
R1067:Herc6 UTSW 6 57662219 missense probably damaging 1.00
R1740:Herc6 UTSW 6 57652065 missense probably benign
R1840:Herc6 UTSW 6 57658106 nonsense probably null
R1889:Herc6 UTSW 6 57662075 nonsense probably null
R1938:Herc6 UTSW 6 57625941 missense probably damaging 1.00
R2024:Herc6 UTSW 6 57583332 missense probably benign 0.04
R2051:Herc6 UTSW 6 57625976 missense probably benign 0.00
R2238:Herc6 UTSW 6 57654401 missense probably benign 0.05
R2244:Herc6 UTSW 6 57598617 nonsense probably null
R4085:Herc6 UTSW 6 57647069 missense probably benign 0.09
R4410:Herc6 UTSW 6 57659679 missense possibly damaging 0.82
R4490:Herc6 UTSW 6 57654495 missense probably damaging 1.00
R4599:Herc6 UTSW 6 57659713 missense probably benign 0.34
R4716:Herc6 UTSW 6 57598438 missense probably damaging 1.00
R4757:Herc6 UTSW 6 57600060 critical splice donor site probably null
R4761:Herc6 UTSW 6 57662900 missense probably benign 0.01
R4798:Herc6 UTSW 6 57604166 missense probably damaging 1.00
R5520:Herc6 UTSW 6 57647120 missense possibly damaging 0.51
R5545:Herc6 UTSW 6 57658007 critical splice acceptor site probably null
R5664:Herc6 UTSW 6 57618684 missense probably benign
R5763:Herc6 UTSW 6 57662887 missense probably damaging 1.00
R5916:Herc6 UTSW 6 57646203 missense probably benign
R6115:Herc6 UTSW 6 57583206 missense probably benign 0.01
R6225:Herc6 UTSW 6 57662154 missense possibly damaging 0.50
R7287:Herc6 UTSW 6 57651980 splice site probably null
R7319:Herc6 UTSW 6 57604089 missense probably damaging 1.00
R7375:Herc6 UTSW 6 57651806 splice site probably null
R7480:Herc6 UTSW 6 57581221 missense possibly damaging 0.66
R7485:Herc6 UTSW 6 57581104 missense probably benign 0.00
R7670:Herc6 UTSW 6 57660122 missense probably damaging 1.00
R7740:Herc6 UTSW 6 57659817 splice site probably null
R7914:Herc6 UTSW 6 57607121 missense probably benign 0.03
R8356:Herc6 UTSW 6 57598563 missense probably benign 0.02
R8403:Herc6 UTSW 6 57583206 missense probably benign 0.01
R8456:Herc6 UTSW 6 57598563 missense probably benign 0.02
Z1176:Herc6 UTSW 6 57600031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCCATTGAAAACTTAAACAC -3'
(R):5'- CATCATGTCAGTGAACATTTGAGTT -3'

Sequencing Primer
(F):5'- AGAGAACCTGGTTCCATCTCTAG -3'
(R):5'- GCCTCAGTTAGTTTGGCAT -3'
Posted On2016-03-01