Incidental Mutation 'R4885:Macrod2'
ID375618
Institutional Source Beutler Lab
Gene Symbol Macrod2
Ensembl Gene ENSMUSG00000068205
Gene NameMACRO domain containing 2
Synonyms2900006F19Rik, 1110033L15Rik, 2610107G07Rik
MMRRC Submission 042851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4885 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140395309-142392966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140420065 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000041780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043836] [ENSMUST00000078027] [ENSMUST00000110061] [ENSMUST00000110062] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043836
AA Change: T89A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110061
SMART Domains Protein: ENSMUSP00000105688
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110062
SMART Domains Protein: ENSMUSP00000105689
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154505
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,551,675 T317A probably benign Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adgrb1 A T 15: 74,572,162 M1038L probably benign Het
Anapc10 C T 8: 79,729,150 T76I probably benign Het
Bptf C T 11: 107,074,648 S1177N probably benign Het
Bsn A T 9: 108,107,527 Y337* probably null Het
C77080 C T 4: 129,224,445 R214Q probably damaging Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccl20 T A 1: 83,117,859 V48E possibly damaging Het
Ccnl1 C T 3: 65,956,899 D122N probably damaging Het
Chat C G 14: 32,454,610 G69A probably damaging Het
Cr2 T A 1: 195,158,731 I418F possibly damaging Het
Dmxl1 G C 18: 49,878,795 A1340P probably damaging Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Eml2 G A 7: 19,204,010 S793N probably benign Het
Enox1 T A 14: 77,720,850 L632Q probably damaging Het
Fabp9 T C 3: 10,194,678 K92E probably damaging Het
Fam214a T C 9: 75,006,367 L94P probably damaging Het
Fam234a T C 17: 26,213,585 H530R probably benign Het
Fancm C T 12: 65,102,643 Q728* probably null Het
Fgd3 G A 13: 49,263,989 T666M possibly damaging Het
Foxs1 T C 2: 152,932,381 M251V probably benign Het
Fsip2 A T 2: 82,988,094 M4724L probably benign Het
Gemin6 G A 17: 80,227,898 E96K probably damaging Het
Gfi1 C A 5: 107,723,286 V80F probably damaging Het
Hectd1 A G 12: 51,800,722 V442A probably damaging Het
Hist2h3b G T 3: 96,268,961 V90F possibly damaging Het
Ift80 A G 3: 68,950,496 I272T probably damaging Het
Impact C G 18: 12,986,373 A214G probably damaging Het
Insl6 C T 19: 29,325,156 E54K probably benign Het
Irak3 T A 10: 120,182,681 D54V probably damaging Het
Itk C T 11: 46,336,344 probably null Het
Ivl A T 3: 92,572,411 C116S probably benign Het
Kcnq4 G A 4: 120,713,063 A361V probably benign Het
L1td1 C T 4: 98,737,311 P581L probably benign Het
Lrp1b T C 2: 41,468,893 E656G probably benign Het
Mettl13 T C 1: 162,537,268 D514G probably damaging Het
Mfsd13b A T 7: 120,991,488 I151F possibly damaging Het
Mical3 G A 6: 120,935,253 P1882S probably damaging Het
Mycbp2 T C 14: 103,145,946 E394G possibly damaging Het
Myo16 T A 8: 10,438,892 S688T probably damaging Het
Neb T C 2: 52,286,046 Y1467C probably damaging Het
Nkx6-3 C A 8: 23,153,898 P105Q possibly damaging Het
Nlrp1b T C 11: 71,217,884 T264A possibly damaging Het
Nnat G A 2: 157,561,758 C122Y probably damaging Het
Notch3 G A 17: 32,141,377 R1527C probably damaging Het
Olfr1388 C T 11: 49,444,622 T257I probably damaging Het
Olfr186 A G 16: 59,027,155 Y251H probably damaging Het
Olfr262 T G 19: 12,240,718 probably null Het
Pds5b C T 5: 150,716,462 T14I probably benign Het
Phf19 A T 2: 34,899,706 I334N probably damaging Het
Pik3ap1 T C 19: 41,375,926 D118G probably benign Het
Pkhd1 T A 1: 20,070,488 E3886V possibly damaging Het
Pkp1 A G 1: 135,918,952 S21P possibly damaging Het
Rack1 C A 11: 48,805,636 A290E probably damaging Het
Rbm15 A G 3: 107,332,254 V276A probably benign Het
Rnf216 A T 5: 143,090,580 L183* probably null Het
Sc5d T C 9: 42,255,626 I206V probably benign Het
Scpep1 A G 11: 88,935,911 I233T probably benign Het
Sh3pxd2a A G 19: 47,268,693 Y529H probably damaging Het
Slc1a4 A C 11: 20,304,384 V494G probably damaging Het
Slc38a7 T C 8: 95,848,602 T17A probably benign Het
Smg6 T C 11: 75,041,918 S73P probably damaging Het
Stk32b T C 5: 37,466,797 Y202C probably damaging Het
Tas2r137 A G 6: 40,491,400 S55G probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Ttc3 T C 16: 94,419,465 I568T probably damaging Het
Ttc3 G C 16: 94,426,831 probably null Het
Ttc41 T G 10: 86,759,102 N913K possibly damaging Het
Vrk1 G A 12: 106,057,972 V236M probably damaging Het
Wscd1 C T 11: 71,760,146 R100C probably damaging Het
Zc3h18 C T 8: 122,401,706 probably benign Het
Other mutations in Macrod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Macrod2 APN 2 140400877 missense probably damaging 0.99
IGL00661:Macrod2 APN 2 140419904 critical splice acceptor site probably null
IGL00788:Macrod2 APN 2 142210149 splice site probably benign
IGL00840:Macrod2 APN 2 142176658 missense possibly damaging 0.53
IGL01160:Macrod2 APN 2 140825042 splice site probably benign
IGL01357:Macrod2 APN 2 142384330 missense probably damaging 1.00
IGL01453:Macrod2 APN 2 140452572 splice site probably benign
IGL01910:Macrod2 APN 2 142296565 missense probably benign 0.04
IGL02208:Macrod2 APN 2 142374276 missense possibly damaging 0.55
IGL03013:Macrod2 APN 2 141515227 missense probably benign 0.02
R0196:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R0415:Macrod2 UTSW 2 142210145 critical splice donor site probably null
R0699:Macrod2 UTSW 2 140418916 critical splice donor site probably null
R0730:Macrod2 UTSW 2 142217674 splice site probably benign
R1119:Macrod2 UTSW 2 140400906 missense probably benign 0.00
R1124:Macrod2 UTSW 2 140452627 missense probably damaging 1.00
R1422:Macrod2 UTSW 2 140419941 splice site probably null
R3707:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3708:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3745:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R4409:Macrod2 UTSW 2 140418857 missense possibly damaging 0.66
R4666:Macrod2 UTSW 2 142217599 missense probably damaging 0.99
R4782:Macrod2 UTSW 2 140419938 missense possibly damaging 0.81
R5180:Macrod2 UTSW 2 140395716 missense probably damaging 1.00
R5524:Macrod2 UTSW 2 142317943 missense possibly damaging 0.82
R5677:Macrod2 UTSW 2 142176667 missense probably damaging 1.00
R5735:Macrod2 UTSW 2 140418889 missense possibly damaging 0.66
R5750:Macrod2 UTSW 2 141515320 missense probably benign 0.41
R5770:Macrod2 UTSW 2 141232182 intron probably benign
R6029:Macrod2 UTSW 2 142318447 missense probably damaging 0.99
R6174:Macrod2 UTSW 2 140400975 start codon destroyed probably null
R6453:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R6830:Macrod2 UTSW 2 140452682 missense probably damaging 1.00
R6927:Macrod2 UTSW 2 142256521 missense probably damaging 1.00
R6932:Macrod2 UTSW 2 140419913 missense probably damaging 0.97
R7020:Macrod2 UTSW 2 142389875 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACTTAGAGCAGTTGGAACTTATACC -3'
(R):5'- ATCTGAAGTCCAGTTGCCTG -3'

Sequencing Primer
(F):5'- GAGCAGTTGGAACTTATACCTATAAC -3'
(R):5'- GTTGCCTGTCCACACTAGAAG -3'
Posted On2016-03-17