Incidental Mutation 'R1119:Macrod2'
ID97680
Institutional Source Beutler Lab
Gene Symbol Macrod2
Ensembl Gene ENSMUSG00000068205
Gene NameMACRO domain containing 2
Synonyms2900006F19Rik, 1110033L15Rik, 2610107G07Rik
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140395309-142392966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140400906 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 31 (I31L)
Ref Sequence ENSEMBL: ENSMUSP00000105690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043836] [ENSMUST00000078027] [ENSMUST00000110061] [ENSMUST00000110062] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect probably benign
Transcript: ENSMUST00000043836
Predicted Effect probably benign
Transcript: ENSMUST00000078027
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110061
AA Change: I31L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105688
Gene: ENSMUSG00000068205
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110062
AA Change: I31L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105689
Gene: ENSMUSG00000068205
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110063
AA Change: I31L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154505
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Macrod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Macrod2 APN 2 140400877 missense probably damaging 0.99
IGL00661:Macrod2 APN 2 140419904 critical splice acceptor site probably null
IGL00788:Macrod2 APN 2 142210149 splice site probably benign
IGL00840:Macrod2 APN 2 142176658 missense possibly damaging 0.53
IGL01160:Macrod2 APN 2 140825042 splice site probably benign
IGL01357:Macrod2 APN 2 142384330 missense probably damaging 1.00
IGL01453:Macrod2 APN 2 140452572 splice site probably benign
IGL01910:Macrod2 APN 2 142296565 missense probably benign 0.04
IGL02208:Macrod2 APN 2 142374276 missense possibly damaging 0.55
IGL03013:Macrod2 APN 2 141515227 missense probably benign 0.02
R0196:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R0415:Macrod2 UTSW 2 142210145 critical splice donor site probably null
R0699:Macrod2 UTSW 2 140418916 critical splice donor site probably null
R0730:Macrod2 UTSW 2 142217674 splice site probably benign
R1124:Macrod2 UTSW 2 140452627 missense probably damaging 1.00
R1422:Macrod2 UTSW 2 140419941 splice site probably null
R3707:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3708:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3745:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R4409:Macrod2 UTSW 2 140418857 missense possibly damaging 0.66
R4666:Macrod2 UTSW 2 142217599 missense probably damaging 0.99
R4782:Macrod2 UTSW 2 140419938 missense possibly damaging 0.81
R4885:Macrod2 UTSW 2 140420065 missense possibly damaging 0.66
R5180:Macrod2 UTSW 2 140395716 missense probably damaging 1.00
R5524:Macrod2 UTSW 2 142317943 missense possibly damaging 0.82
R5677:Macrod2 UTSW 2 142176667 missense probably damaging 1.00
R5735:Macrod2 UTSW 2 140418889 missense possibly damaging 0.66
R5750:Macrod2 UTSW 2 141515320 missense probably benign 0.41
R5770:Macrod2 UTSW 2 141232182 intron probably benign
R6029:Macrod2 UTSW 2 142318447 missense probably damaging 0.99
R6174:Macrod2 UTSW 2 140400975 start codon destroyed probably null
R6453:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R6830:Macrod2 UTSW 2 140452682 missense probably damaging 1.00
R6927:Macrod2 UTSW 2 142256521 missense probably damaging 1.00
R6932:Macrod2 UTSW 2 140419913 missense probably damaging 0.97
R7020:Macrod2 UTSW 2 142389875 makesense probably null
R7886:Macrod2 UTSW 2 141724645 missense probably damaging 1.00
R7969:Macrod2 UTSW 2 141724645 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 140706208 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 141024090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTAGGAGCTTTGTCTTGACCAAC -3'
(R):5'- TGCCACACCACCATTGAGTAAATGTC -3'

Sequencing Primer
(F):5'- CTGTGGAATTAACTTGAACTCCC -3'
(R):5'- CCCAAGCTTAAGAACTATGTGATAGG -3'
Posted On2014-01-05