Incidental Mutation 'R1422:Macrod2'
ID161114
Institutional Source Beutler Lab
Gene Symbol Macrod2
Ensembl Gene ENSMUSG00000068205
Gene NameMACRO domain containing 2
Synonyms2900006F19Rik, 1110033L15Rik, 2610107G07Rik
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140395309-142392966 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 140419941 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043836] [ENSMUST00000078027] [ENSMUST00000110061] [ENSMUST00000110061] [ENSMUST00000110062] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect silent
Transcript: ENSMUST00000043836
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110061
SMART Domains Protein: ENSMUSP00000105688
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably null
Transcript: ENSMUST00000110061
SMART Domains Protein: ENSMUSP00000105688
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110062
SMART Domains Protein: ENSMUSP00000105689
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 54 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154505
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Macrod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Macrod2 APN 2 140400877 missense probably damaging 0.99
IGL00661:Macrod2 APN 2 140419904 critical splice acceptor site probably null
IGL00788:Macrod2 APN 2 142210149 splice site probably benign
IGL00840:Macrod2 APN 2 142176658 missense possibly damaging 0.53
IGL01160:Macrod2 APN 2 140825042 splice site probably benign
IGL01357:Macrod2 APN 2 142384330 missense probably damaging 1.00
IGL01453:Macrod2 APN 2 140452572 splice site probably benign
IGL01910:Macrod2 APN 2 142296565 missense probably benign 0.04
IGL02208:Macrod2 APN 2 142374276 missense possibly damaging 0.55
IGL03013:Macrod2 APN 2 141515227 missense probably benign 0.02
R0196:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R0415:Macrod2 UTSW 2 142210145 critical splice donor site probably null
R0699:Macrod2 UTSW 2 140418916 critical splice donor site probably null
R0730:Macrod2 UTSW 2 142217674 splice site probably benign
R1119:Macrod2 UTSW 2 140400906 missense probably benign 0.00
R1124:Macrod2 UTSW 2 140452627 missense probably damaging 1.00
R3707:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3708:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3745:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R4409:Macrod2 UTSW 2 140418857 missense possibly damaging 0.66
R4666:Macrod2 UTSW 2 142217599 missense probably damaging 0.99
R4782:Macrod2 UTSW 2 140419938 missense possibly damaging 0.81
R4885:Macrod2 UTSW 2 140420065 missense possibly damaging 0.66
R5180:Macrod2 UTSW 2 140395716 missense probably damaging 1.00
R5524:Macrod2 UTSW 2 142317943 missense possibly damaging 0.82
R5677:Macrod2 UTSW 2 142176667 missense probably damaging 1.00
R5735:Macrod2 UTSW 2 140418889 missense possibly damaging 0.66
R5750:Macrod2 UTSW 2 141515320 missense probably benign 0.41
R5770:Macrod2 UTSW 2 141232182 intron probably benign
R6029:Macrod2 UTSW 2 142318447 missense probably damaging 0.99
R6174:Macrod2 UTSW 2 140400975 start codon destroyed probably null
R6453:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R6830:Macrod2 UTSW 2 140452682 missense probably damaging 1.00
R6927:Macrod2 UTSW 2 142256521 missense probably damaging 1.00
R6932:Macrod2 UTSW 2 140419913 missense probably damaging 0.97
R7020:Macrod2 UTSW 2 142389875 makesense probably null
R7886:Macrod2 UTSW 2 141724645 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 140706208 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 141024090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGCTTAACCATTTGACACCCTG -3'
(R):5'- AAACTGCATGTGTCTCCCACCC -3'

Sequencing Primer
(F):5'- CCCTAGAGTAGTGGAGATTCAAGTTC -3'
(R):5'- ATGTGTCTCCCACCCTTCTTG -3'
Posted On2014-03-14