Incidental Mutation 'R4899:Sox7'
ID 376037
Institutional Source Beutler Lab
Gene Symbol Sox7
Ensembl Gene ENSMUSG00000063060
Gene Name SRY (sex determining region Y)-box 7
Synonyms
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4899 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 63943673-63950732 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 63948478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 321 (R321H)
Ref Sequence ENSEMBL: ENSMUSP00000078597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079652]
AlphaFold P40646
Predicted Effect probably damaging
Transcript: ENSMUST00000079652
AA Change: R321H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078597
Gene: ENSMUSG00000063060
AA Change: R321H

DomainStartEndE-ValueType
HMG 44 114 8.74e-27 SMART
Pfam:Sox_C_TAD 171 378 1.4e-58 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a knock-out allele exhibit embryonic growth retardation, abnormal vitelline vascular remodeling and pericardial edema, and die during organogenesis. Depending on the genetic background, a portion of heterozygotes can develop congenital retrosternal diaphragmatic hernias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Sox7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sox7 APN 14 63948187 missense probably benign 0.00
R0378:Sox7 UTSW 14 63943949 missense probably damaging 0.99
R3147:Sox7 UTSW 14 63948634 missense probably damaging 1.00
R4350:Sox7 UTSW 14 63948546 missense probably benign 0.02
R5217:Sox7 UTSW 14 63948000 missense probably damaging 0.97
R5418:Sox7 UTSW 14 63947947 missense probably benign 0.30
R5477:Sox7 UTSW 14 63948496 missense probably damaging 1.00
R6603:Sox7 UTSW 14 63948188 missense probably benign 0.06
R7216:Sox7 UTSW 14 63947989 missense probably benign 0.42
R7312:Sox7 UTSW 14 63947842 missense probably damaging 1.00
R7812:Sox7 UTSW 14 63948232 missense probably benign 0.09
R8310:Sox7 UTSW 14 63943826 missense probably benign 0.03
R8716:Sox7 UTSW 14 63948588 missense probably benign 0.00
Z1177:Sox7 UTSW 14 63947865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCACCGGAGTTCACACCTAG -3'
(R):5'- AGCTGTTGTAATACGTGGCC -3'

Sequencing Primer
(F):5'- CAATCCCCAGGGGTTTCTATGATG -3'
(R):5'- CGTGGCCGTGGCATCAG -3'
Posted On 2016-03-17