Mutagenetix > Incidental Mutations

Incidental Mutation 'R4899:Sox7'

376037

Institutional Source

Beutler Lab

Gene Symbol

Sox7

Ensembl Gene

ENSMUSG00000063060

Gene Name

SRY (sex determining region Y)-box 7

Synonyms

MMRRC Submission

042503-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63943673-63950732 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63948478 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 321 (R321H)

Ref Sequence

ENSEMBL: ENSMUSP00000078597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079652]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079652
AA Change: R321H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078597
Gene: ENSMUSG00000063060
AA Change: R321H

Domain	Start	End	E-Value	Type
HMG	44	114	8.74e-27	SMART
Pfam:Sox_C_TAD	171	378	1.4e-58	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a knock-out allele exhibit embryonic growth retardation, abnormal vitelline vascular remodeling and pericardial edema, and die during organogenesis. Depending on the genetic background, a portion of heterozygotes can develop congenital retrosternal diaphragmatic hernias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010005H15Rik	A	T	16: 36,257,365	Y96F	possibly damaging	Het
9230110C19Rik	A	T	9: 8,022,493	S243T	possibly damaging	Het
Abhd18	C	G	3: 40,905,869		probably null	Het
Adra2c	A	T	5: 35,280,361	Y159F	probably damaging	Het
AI481877	T	C	4: 59,062,640	Y872C	probably damaging	Het
Alkal2	T	A	12: 30,884,973	S64T	probably benign	Het
Apbb1ip	T	C	2: 22,823,349	V72A	unknown	Het
Atp13a5	A	G	16: 29,378,500	L13P	probably damaging	Het
Azin2	G	A	4: 128,934,653	P254S	probably benign	Het
Bmpr1b	T	C	3: 141,840,683	R481G	probably damaging	Het
Cacna2d4	G	A	6: 119,268,196	W288*	probably null	Het
Cass4	A	G	2: 172,427,869	T626A	probably benign	Het
Cep112	T	A	11: 108,606,284	D683E	probably damaging	Het
Chat	G	T	14: 32,448,977	S188R	possibly damaging	Het
Cit	A	G	5: 115,863,028	Y162C	possibly damaging	Het
Clca3a1	T	A	3: 144,737,961	Y676F	probably damaging	Het
Clec2h	A	G	6: 128,675,824	N185D	probably benign	Het
Cnbd2	G	T	2: 156,339,221	V192F	probably benign	Het
Col6a3	C	A	1: 90,802,427	G1112V	probably damaging	Het
Cyp3a25	A	G	5: 145,977,671	F483S	possibly damaging	Het
Dscam	T	C	16: 96,683,818	E1103G	probably benign	Het
Dync2h1	G	A	9: 7,131,921	Q1629*	probably null	Het
E330014E10Rik	T	C	5: 95,801,727	V111A	probably benign	Het
Enpp6	A	G	8: 46,987,083	Y38C	probably damaging	Het
Epg5	T	A	18: 77,985,057	L1271Q	probably damaging	Het
Fam47e	G	A	5: 92,574,669	V75I	probably benign	Het
Fat3	T	C	9: 15,969,799	D3259G	probably damaging	Het
Fbxw28	T	C	9: 109,330,853	D211G	probably damaging	Het
Flnc	A	G	6: 29,446,843	N990D	probably benign	Het
Frat1	T	G	19: 41,830,322	L52R	probably damaging	Het
Ftmt	C	G	18: 52,331,586		probably benign	Het
H2-M1	C	T	17: 36,671,220	G163D	probably benign	Het
Hapln1	A	G	13: 89,601,650	K105E	possibly damaging	Het
Igkv17-127	G	T	6: 67,861,397	A31S	probably benign	Het
Il6st	T	C	13: 112,501,161	L628P	probably damaging	Het
Kcnj6	A	G	16: 94,832,613	I213T	probably damaging	Het
Kidins220	T	C	12: 25,013,443		probably null	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Marc2	A	T	1: 184,845,624	I65N	probably damaging	Het
Mertk	C	A	2: 128,783,925	P660Q	probably damaging	Het
Mkl1	A	G	15: 81,018,386	Y241H	probably damaging	Het
Napepld	A	G	5: 21,683,440	Y4H	probably benign	Het
Ncam1	T	A	9: 49,545,251		probably null	Het
Nuak2	A	T	1: 132,324,986	K93*	probably null	Het
Oat	A	T	7: 132,564,222	D211E	probably benign	Het
Olfr1214	A	C	2: 88,988,110	L31V	probably null	Het
Olfr1355	A	T	10: 78,879,207	S12C	probably benign	Het
Olfr171	G	A	16: 19,624,200	A300V	probably benign	Het
Olfr348	A	G	2: 36,786,798	Q91R	probably benign	Het
Olfr64	A	G	7: 103,893,465	I90T	possibly damaging	Het
Pde4dip	C	A	3: 97,709,558	K1789N	probably damaging	Het
Piezo2	T	C	18: 63,078,791	I1322V	possibly damaging	Het
Pih1d1	A	G	7: 45,154,527		probably benign	Het
Plekhd1	T	C	12: 80,722,327	S454P	probably damaging	Het
Polr2h	G	A	16: 20,720,553	V89M	probably damaging	Het
Pptc7	G	A	5: 122,284,717	G17S	possibly damaging	Het
Ptpra	T	C	2: 130,544,436	V602A	probably damaging	Het
Rnf123	C	T	9: 108,063,680	R654H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	A	G	16: 75,879,103	S135P	probably damaging	Het
Sgsm3	A	G	15: 81,006,779	N147S	probably benign	Het
Slc22a29	T	C	19: 8,161,569	T510A	probably benign	Het
Smc4	T	A	3: 69,031,811	H978Q	probably damaging	Het
Spred3	T	C	7: 29,161,833	D307G	probably damaging	Het
Syne2	T	A	12: 75,854,101	D11E	probably benign	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,214,452		probably benign	Het
Top2b	A	T	14: 16,387,313	I134F	probably damaging	Het
Tspan1	T	A	4: 116,163,366	R206*	probably null	Het
Ttc3	A	T	16: 94,429,455	N837I	probably damaging	Het
Vmn1r36	T	C	6: 66,716,565	T72A	possibly damaging	Het
Vmn2r10	A	G	5: 109,003,458	S97P	probably damaging	Het
Zfp2	T	A	11: 50,900,014	I401F	probably damaging	Het
Zfp629	T	C	7: 127,611,018	T540A	possibly damaging	Het
Zfr	G	A	15: 12,166,145	V834I	probably benign	Het

Other mutations in Sox7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Sox7	APN	14	63948187	missense	probably benign	0.00
R0378:Sox7	UTSW	14	63943949	missense	probably damaging	0.99
R3147:Sox7	UTSW	14	63948634	missense	probably damaging	1.00
R4350:Sox7	UTSW	14	63948546	missense	probably benign	0.02
R5217:Sox7	UTSW	14	63948000	missense	probably damaging	0.97
R5418:Sox7	UTSW	14	63947947	missense	probably benign	0.30
R5477:Sox7	UTSW	14	63948496	missense	probably damaging	1.00
R6603:Sox7	UTSW	14	63948188	missense	probably benign	0.06
R7216:Sox7	UTSW	14	63947989	missense	probably benign	0.42
R7312:Sox7	UTSW	14	63947842	missense	probably damaging	1.00
R7812:Sox7	UTSW	14	63948232	missense	probably benign	0.09
Z1177:Sox7	UTSW	14	63947865	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCGGAGTTCACACCTAG -3'
(R):5'- AGCTGTTGTAATACGTGGCC -3'

Sequencing Primer
(F):5'- CAATCCCCAGGGGTTTCTATGATG -3'
(R):5'- CGTGGCCGTGGCATCAG -3'

Posted On

2016-03-17