Incidental Mutation 'R4899:Chat'
ID376036
Institutional Source Beutler Lab
Gene Symbol Chat
Ensembl Gene ENSMUSG00000021919
Gene Namecholine acetyltransferase
SynonymsB230380D24Rik
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R4899 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32408203-32465989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32448977 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 188 (S188R)
Ref Sequence ENSEMBL: ENSMUSP00000153738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070125] [ENSMUST00000226365] [ENSMUST00000227579]
Predicted Effect probably benign
Transcript: ENSMUST00000070125
AA Change: S188R

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919
AA Change: S188R

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 24 612 5.5e-190 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226365
AA Change: S188R

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227579
AA Change: S188R

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227675
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutation of this gene results in hyperinnervation of motor neurons, abnormal morphology and patterning of neuromuscular synapses, and perinatal lethality. Mutant fetuses at E18.5 exhibit a hunched position, reduced body length, and carpoptosis(drop wrist). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Chat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Chat APN 14 32449023 missense probably damaging 0.98
IGL01618:Chat APN 14 32446892 unclassified probably null
IGL02192:Chat APN 14 32423322 missense possibly damaging 0.94
IGL02418:Chat APN 14 32446949 missense possibly damaging 0.74
IGL02851:Chat APN 14 32458613 missense probably benign
IGL02966:Chat APN 14 32448946 missense probably damaging 1.00
IGL03401:Chat APN 14 32452569 missense probably damaging 1.00
R0511:Chat UTSW 14 32409019 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1729:Chat UTSW 14 32446795 missense probably damaging 1.00
R1782:Chat UTSW 14 32408987 missense probably damaging 1.00
R1972:Chat UTSW 14 32424191 missense probably benign 0.03
R1973:Chat UTSW 14 32424191 missense probably benign 0.03
R2061:Chat UTSW 14 32446873 missense probably benign 0.00
R2270:Chat UTSW 14 32454581 missense probably damaging 0.99
R4012:Chat UTSW 14 32423312 missense possibly damaging 0.56
R4601:Chat UTSW 14 32424155 missense probably benign 0.00
R4620:Chat UTSW 14 32453818 missense probably damaging 1.00
R4760:Chat UTSW 14 32453737 missense probably benign
R4885:Chat UTSW 14 32454610 missense probably damaging 1.00
R4940:Chat UTSW 14 32419105 missense probably damaging 1.00
R4960:Chat UTSW 14 32420814 missense possibly damaging 0.86
R5094:Chat UTSW 14 32408939 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6621:Chat UTSW 14 32419013 missense probably damaging 0.97
R6648:Chat UTSW 14 32454694 missense probably benign 0.17
R6980:Chat UTSW 14 32424154 missense probably benign 0.15
R7203:Chat UTSW 14 32419057 missense probably damaging 1.00
R7336:Chat UTSW 14 32423256 splice site probably null
R7530:Chat UTSW 14 32408958 nonsense probably null
X0014:Chat UTSW 14 32446933 missense probably benign 0.01
X0066:Chat UTSW 14 32453831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGGACTGACTAGGAAGTTC -3'
(R):5'- AAGGTTACCACAGAGCCCATG -3'

Sequencing Primer
(F):5'- ATGCCCCAAGCTCACTGTATG -3'
(R):5'- GAGCCCATGCCAATGCCTTC -3'
Posted On2016-03-17