Incidental Mutation 'R4917:Dclk2'
ID378273
Institutional Source Beutler Lab
Gene Symbol Dclk2
Ensembl Gene ENSMUSG00000028078
Gene Namedoublecortin-like kinase 2
SynonymsDcamkl2, Click-II, 6330415M09Rik
MMRRC Submission 042519-MU
Accession Numbers

Genbank: NM_027539; MGI: 1918012

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86786151-86920852 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86824742 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000029719] [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000191752] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000192773] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000193632] [ENSMUST00000193632] [ENSMUST00000193632] [ENSMUST00000193632] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000194452] [ENSMUST00000194452] [ENSMUST00000195561] [ENSMUST00000195561] [ENSMUST00000195561]
Predicted Effect probably null
Transcript: ENSMUST00000029719
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000029719
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000029719
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191752
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191752
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191752
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192773
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192773
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192773
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194452
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000194452
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000194452
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195561
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195561
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195561
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cacna1s T A 1: 136,101,564 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
Cyp2e1 T C 7: 140,774,614 S393P possibly damaging Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Dclk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dclk2 APN 3 86799090 critical splice acceptor site probably null
IGL01769:Dclk2 APN 3 86816360 missense possibly damaging 0.50
IGL01802:Dclk2 APN 3 86799027 missense probably damaging 1.00
IGL02296:Dclk2 APN 3 86793293 missense probably damaging 1.00
IGL02390:Dclk2 APN 3 86824683 missense probably damaging 0.99
IGL02522:Dclk2 APN 3 86920116 missense probably benign 0.01
IGL03104:Dclk2 APN 3 86836359 missense probably damaging 1.00
IGL03337:Dclk2 APN 3 86906059 missense probably damaging 1.00
R0219:Dclk2 UTSW 3 86813669 splice site probably benign
R0400:Dclk2 UTSW 3 86813747 splice site probably null
R0606:Dclk2 UTSW 3 86906004 missense probably damaging 1.00
R1537:Dclk2 UTSW 3 86806184 missense probably damaging 0.97
R1569:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1571:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1612:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1680:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1689:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1714:Dclk2 UTSW 3 86906093 missense probably benign 0.00
R1745:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1746:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1752:Dclk2 UTSW 3 86806127 missense possibly damaging 0.61
R1829:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2008:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2125:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2126:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2132:Dclk2 UTSW 3 86920046 missense probably benign 0.44
R2314:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2338:Dclk2 UTSW 3 86799017 missense probably damaging 1.00
R2849:Dclk2 UTSW 3 86793223 missense probably damaging 1.00
R3108:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3109:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3615:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3616:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R4051:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4052:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4208:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4643:Dclk2 UTSW 3 86806180 missense possibly damaging 0.93
R4654:Dclk2 UTSW 3 86836376 missense probably damaging 1.00
R4693:Dclk2 UTSW 3 86815093 missense possibly damaging 0.67
R4716:Dclk2 UTSW 3 86919881 missense probably damaging 1.00
R4914:Dclk2 UTSW 3 86824742 splice site probably null
R4915:Dclk2 UTSW 3 86824742 splice site probably null
R5218:Dclk2 UTSW 3 86805678 missense probably damaging 1.00
R5510:Dclk2 UTSW 3 86906037 missense possibly damaging 0.93
R5520:Dclk2 UTSW 3 86919840 missense probably damaging 1.00
R5867:Dclk2 UTSW 3 86791859 makesense probably null
R5976:Dclk2 UTSW 3 86787225 missense possibly damaging 0.53
R6048:Dclk2 UTSW 3 86905965 missense probably damaging 1.00
R6111:Dclk2 UTSW 3 86805661 missense probably benign 0.28
R6192:Dclk2 UTSW 3 86815150 missense probably damaging 1.00
R6289:Dclk2 UTSW 3 86831817 missense probably benign 0.18
R6595:Dclk2 UTSW 3 86792067 critical splice donor site probably benign
R6897:Dclk2 UTSW 3 86831763 missense probably benign 0.00
R7061:Dclk2 UTSW 3 86831731 critical splice donor site probably null
R7095:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7096:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7208:Dclk2 UTSW 3 86799602 splice site probably null
R7253:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7256:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R8003:Dclk2 UTSW 3 86793301 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGCCTTTAGAAGCTCACAC -3'
(R):5'- ATGGACAGGGTCTCTCACTC -3'

Sequencing Primer
(F):5'- TTTAGAAGCTCACACCACACAG -3'
(R):5'- ACTCACACCTGTAATTCCATGATTG -3'
Posted On2016-04-15