Incidental Mutation 'R4932:Scn10a'
ID380652
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R4932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 119687874 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably null
Transcript: ENSMUST00000084787
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213392
Predicted Effect probably null
Transcript: ENSMUST00000214408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216583
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,932,630 T121S possibly damaging Het
Abcf1 A T 17: 35,959,450 V616E possibly damaging Het
Adam21 A G 12: 81,558,918 V690A probably benign Het
Afg3l1 A T 8: 123,501,380 T635S probably damaging Het
Ahcyl2 T A 6: 29,890,701 M390K probably benign Het
Ank3 T A 10: 69,898,223 probably null Het
Arhgef3 A T 14: 27,384,213 K151N probably damaging Het
Ccr3 T G 9: 124,029,006 F126C probably damaging Het
Ccser1 A G 6: 61,718,191 D170G possibly damaging Het
Celsr2 T A 3: 108,402,758 D1552V probably damaging Het
Cfap69 G A 5: 5,625,820 L265F probably damaging Het
Chrna9 C T 5: 65,969,190 R96* probably null Het
Cog3 A T 14: 75,732,954 V351D probably damaging Het
Csmd1 C A 8: 16,023,765 R2072L probably damaging Het
Dbf4 G T 5: 8,398,039 H390Q probably benign Het
Dcaf4 T A 12: 83,532,304 C166S possibly damaging Het
Dclk3 T A 9: 111,468,042 L218Q possibly damaging Het
Dip2b T A 15: 100,171,722 W643R probably damaging Het
Dip2c A G 13: 9,623,972 K1091E probably damaging Het
Dis3 T A 14: 99,088,904 H415L probably damaging Het
Dnah7a T A 1: 53,503,578 I2478F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Doc2a T C 7: 126,848,580 probably benign Het
Dph5 A T 3: 115,899,807 M125L probably benign Het
Dst A T 1: 34,228,683 T5247S possibly damaging Het
Eno4 T G 19: 58,964,457 V477G possibly damaging Het
Exosc8 T C 3: 54,729,290 I207V possibly damaging Het
Fam173a T G 17: 25,791,678 probably null Het
Fat4 T A 3: 39,007,203 S4312T probably benign Het
Fgfr2 T C 7: 130,241,277 D126G probably damaging Het
Fgfr4 A G 13: 55,168,170 T799A unknown Het
Gcn1l1 A T 5: 115,592,144 D839V probably benign Het
Gprin3 A G 6: 59,354,173 V383A probably benign Het
Gpt T C 15: 76,698,840 V361A probably benign Het
Hepacam G A 9: 37,381,764 C217Y probably damaging Het
Hsp90aa1 A T 12: 110,693,717 Y382N probably damaging Het
Htr2a T A 14: 74,642,022 N30K probably benign Het
Jhy A T 9: 40,961,003 M70K possibly damaging Het
Lrrc19 T C 4: 94,640,937 Y36C probably damaging Het
Madcam1 C T 10: 79,665,613 Q171* probably null Het
Mcm8 G A 2: 132,838,709 M544I probably benign Het
Mdga1 C T 17: 29,857,606 G338E probably damaging Het
Mettl7a1 T A 15: 100,305,106 F87Y probably benign Het
Mmp3 A G 9: 7,446,994 D58G probably benign Het
Ms4a10 T C 19: 10,964,768 Y123C probably damaging Het
Ms4a4d T A 19: 11,557,932 I198K probably benign Het
Mthfd1l A T 10: 3,980,241 D112V probably benign Het
N4bp2l2 A C 5: 150,643,141 S567R probably benign Het
Ndufaf2 A G 13: 108,158,476 Y32H probably damaging Het
Nup153 T A 13: 46,712,737 K251* probably null Het
Olfr1186 A G 2: 88,525,735 T51A probably benign Het
Olfr481 T A 7: 108,081,574 V260E probably damaging Het
Olfr551 A G 7: 102,588,416 F109S probably damaging Het
Otoa T C 7: 121,155,135 S928P probably damaging Het
Oxct2a T C 4: 123,322,703 D295G probably benign Het
P4ha2 C A 11: 54,125,020 T411K probably benign Het
Plcg2 A T 8: 117,607,083 Q865L probably benign Het
Prepl G T 17: 85,078,504 T244K possibly damaging Het
Ptpro A T 6: 137,411,105 K776* probably null Het
Rc3h2 T C 2: 37,389,832 K462E possibly damaging Het
Serpinb1c A G 13: 32,882,164 V266A probably damaging Het
Slc6a20b T A 9: 123,604,796 N326Y probably damaging Het
Spcs2 C T 7: 99,858,831 G16D possibly damaging Het
Spns3 T C 11: 72,499,495 D441G possibly damaging Het
Srsf4 A G 4: 131,891,245 D49G probably damaging Het
Tec A T 5: 72,760,393 C494* probably null Het
Tecpr1 A T 5: 144,204,658 Y798N probably damaging Het
Trim56 C T 5: 137,114,489 E58K probably damaging Het
Ttn A T 2: 76,796,134 D13146E probably damaging Het
Ube2q1 A T 3: 89,779,483 K215* probably null Het
Ucn G T 5: 31,138,498 T8K probably benign Het
Usp25 T C 16: 77,033,982 probably null Het
Usp48 A T 4: 137,615,833 Q430L probably benign Het
Usp48 A T 4: 137,615,834 Q430H probably null Het
Vill A T 9: 119,061,511 D164V probably damaging Het
Vmn2r91 T A 17: 18,136,489 M806K possibly damaging Het
Wdfy4 T A 14: 33,029,013 Y2256F probably damaging Het
Wsb1 A G 11: 79,251,000 S64P probably damaging Het
Zc3h11a C A 1: 133,624,612 V586F probably benign Het
Zc3h12d A G 10: 7,853,250 D126G probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp442 T A 2: 150,409,715 H89L possibly damaging Het
Zfp82 T A 7: 30,056,887 K287* probably null Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 unclassified probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 unclassified probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 unclassified probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 unclassified probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
Possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCTCTACATACTTTTCTGTAAGG -3'
(R):5'- TGACATTAGCTGAGTTGCCAG -3'

Sequencing Primer
(F):5'- GAAATCAGTCCCTTTAGGCATCTGAG -3'
(R):5'- AGTTGCCAGCGTCTCCATCAG -3'
Posted OnApr 15, 2016