Incidental Mutation 'R5038:Or5b96'
ID 393137
Institutional Source Beutler Lab
Gene Symbol Or5b96
Ensembl Gene ENSMUSG00000057817
Gene Name olfactory receptor family 5 subfamily B member 96
Synonyms Olfr1446, MOR202-2, GA_x6K02T2RE5P-3220047-3219130
MMRRC Submission 042628-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5038 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12867013-12867939 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12867770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 57 (H57L)
Ref Sequence ENSEMBL: ENSMUSP00000149198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081236] [ENSMUST00000207741] [ENSMUST00000216805]
AlphaFold Q8VFX4
Predicted Effect probably damaging
Transcript: ENSMUST00000081236
AA Change: H57L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079994
Gene: ENSMUSG00000057817
AA Change: H57L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 5.1e-6 PFAM
Pfam:7tm_1 42 291 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207319
AA Change: H57L
Predicted Effect probably damaging
Transcript: ENSMUST00000207741
AA Change: H57L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216805
AA Change: H57L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5999 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,539,375 (GRCm39) probably null Het
Abtb2 G T 2: 103,397,408 (GRCm39) G113C probably damaging Het
Acsm5 A G 7: 119,134,034 (GRCm39) T272A probably damaging Het
Adprs C T 4: 126,211,102 (GRCm39) E272K possibly damaging Het
Agbl5 G A 5: 31,060,403 (GRCm39) R141Q probably damaging Het
Atp7b A C 8: 22,518,472 (GRCm39) I122S possibly damaging Het
B230219D22Rik T C 13: 55,847,288 (GRCm39) Y134H probably damaging Het
Bnc1 A G 7: 81,618,462 (GRCm39) S868P probably damaging Het
Camta1 T C 4: 151,229,926 (GRCm39) E302G probably damaging Het
Car1 A G 3: 14,835,933 (GRCm39) Y129H probably damaging Het
Cdh22 T C 2: 164,984,197 (GRCm39) T352A probably benign Het
Ckmt2 T C 13: 92,009,282 (GRCm39) E215G probably benign Het
Cyb5r4 T G 9: 86,941,130 (GRCm39) probably null Het
Dhrs13 A G 11: 77,923,256 (GRCm39) probably benign Het
Dsg1c G A 18: 20,397,901 (GRCm39) A34T probably benign Het
Epb41l1 T C 2: 156,363,330 (GRCm39) V613A probably benign Het
Fam114a1 A G 5: 65,166,388 (GRCm39) M240V probably damaging Het
Gm15455 T C 1: 33,877,257 (GRCm39) noncoding transcript Het
Herc1 T G 9: 66,383,742 (GRCm39) probably benign Het
Ifna11 T C 4: 88,738,314 (GRCm39) V40A probably benign Het
Ifna15 T C 4: 88,476,266 (GRCm39) N73D probably benign Het
Imp4 A T 1: 34,482,016 (GRCm39) L45F probably damaging Het
Jak3 G A 8: 72,138,702 (GRCm39) A967T probably damaging Het
Krtap19-2 A T 16: 88,670,916 (GRCm39) Y76* probably null Het
Map4k5 A T 12: 69,871,388 (GRCm39) N492K probably damaging Het
Mycbp2 C T 14: 103,534,375 (GRCm39) R372H probably damaging Het
Nos2 G A 11: 78,813,140 (GRCm39) S16N probably benign Het
Nr2c2 A G 6: 92,116,803 (GRCm39) T2A probably damaging Het
Nup188 T C 2: 30,199,232 (GRCm39) Y267H probably damaging Het
Nxph2 G A 2: 23,211,556 (GRCm39) probably null Het
Or5b107 T A 19: 13,142,955 (GRCm39) D192E probably benign Het
Or9i1b T A 19: 13,896,822 (GRCm39) V146E possibly damaging Het
Otof C T 5: 30,541,783 (GRCm39) E761K possibly damaging Het
Pik3r1 C T 13: 101,825,952 (GRCm39) R37Q probably damaging Het
Pkn3 T C 2: 29,975,293 (GRCm39) probably null Het
Pold3 A G 7: 99,770,590 (GRCm39) V14A probably damaging Het
Ptpn14 T C 1: 189,519,083 (GRCm39) S38P probably damaging Het
Raf1 G A 6: 115,597,196 (GRCm39) Q35* probably null Het
Rps3a1 C A 3: 86,045,338 (GRCm39) E251D probably benign Het
Scd1 C T 19: 44,390,148 (GRCm39) V207M probably damaging Het
Shq1 A G 6: 100,607,954 (GRCm39) V319A probably benign Het
Slc4a8 T C 15: 100,693,702 (GRCm39) Y416H probably damaging Het
Slco1a5 T C 6: 142,208,363 (GRCm39) T143A probably benign Het
Slco1a5 C T 6: 142,212,090 (GRCm39) G90D probably damaging Het
Snx9 T C 17: 5,937,348 (GRCm39) V30A probably benign Het
Spdya T C 17: 71,895,561 (GRCm39) probably benign Het
Stat1 A T 1: 52,162,368 (GRCm39) N75I probably damaging Het
Sv2b A T 7: 74,807,173 (GRCm39) M159K probably damaging Het
Tdh A T 14: 63,733,575 (GRCm39) Y89* probably null Het
Tmc7 A G 7: 118,142,588 (GRCm39) F600S probably damaging Het
Trpa1 T A 1: 14,981,090 (GRCm39) H104L probably damaging Het
Ttn G A 2: 76,678,984 (GRCm39) probably benign Het
Vmn1r113 A G 7: 20,521,419 (GRCm39) I70M possibly damaging Het
Vmn1r171 A G 7: 23,332,188 (GRCm39) M138V probably benign Het
Zfc3h1 G A 10: 115,240,116 (GRCm39) V550I probably benign Het
Zfp335 G T 2: 164,752,564 (GRCm39) S60* probably null Het
Zfp7 T C 15: 76,776,010 (GRCm39) M684T probably benign Het
Zfp984 T A 4: 147,839,903 (GRCm39) H316L probably damaging Het
Zmym2 T A 14: 57,193,637 (GRCm39) Y1151N possibly damaging Het
Other mutations in Or5b96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Or5b96 APN 19 12,867,282 (GRCm39) missense probably benign 0.00
IGL01399:Or5b96 APN 19 12,867,803 (GRCm39) missense probably benign 0.28
IGL01697:Or5b96 APN 19 12,867,831 (GRCm39) missense probably benign 0.24
IGL01739:Or5b96 APN 19 12,867,513 (GRCm39) missense probably benign 0.02
IGL01894:Or5b96 APN 19 12,867,007 (GRCm39) utr 3 prime probably benign
R0164:Or5b96 UTSW 19 12,867,809 (GRCm39) missense probably damaging 1.00
R0164:Or5b96 UTSW 19 12,867,809 (GRCm39) missense probably damaging 1.00
R1163:Or5b96 UTSW 19 12,867,513 (GRCm39) missense probably benign 0.02
R1769:Or5b96 UTSW 19 12,867,047 (GRCm39) missense probably damaging 1.00
R4406:Or5b96 UTSW 19 12,867,598 (GRCm39) nonsense probably null
R5207:Or5b96 UTSW 19 12,867,801 (GRCm39) missense probably benign 0.28
R5627:Or5b96 UTSW 19 12,867,663 (GRCm39) missense probably damaging 1.00
R5995:Or5b96 UTSW 19 12,867,961 (GRCm39) splice site probably null
R7953:Or5b96 UTSW 19 12,867,095 (GRCm39) missense probably damaging 1.00
R8043:Or5b96 UTSW 19 12,867,095 (GRCm39) missense probably damaging 1.00
R8254:Or5b96 UTSW 19 12,867,849 (GRCm39) missense probably benign 0.00
R8812:Or5b96 UTSW 19 12,867,560 (GRCm39) missense probably damaging 1.00
R9242:Or5b96 UTSW 19 12,867,989 (GRCm39) intron probably benign
X0062:Or5b96 UTSW 19 12,867,927 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TTCTCCACAGTAGCAAAGGC -3'
(R):5'- CTGGAATGTACAAATACTAGTTGGC -3'

Sequencing Primer
(F):5'- TGTGACAGCTGAGGAGTA -3'
(R):5'- GTACAAATACTAGTTGGCATAGCTAG -3'
Posted On 2016-06-15