Incidental Mutation 'R5257:Olfr221'
ID399820
Institutional Source Beutler Lab
Gene Symbol Olfr221
Ensembl Gene ENSMUSG00000044286
Gene Nameolfactory receptor 221
SynonymsOlfr1514, GA_x6K02T2RJGY-959918-960853, MOR205-1, MOR205-2, GA_x6K02SYYB8M-929-258
MMRRC Submission 042855-MU
Accession Numbers

Genbank: NM_001001808

Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52033962-52042459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52035884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000151163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052560] [ENSMUST00000214071] [ENSMUST00000214342] [ENSMUST00000216188] [ENSMUST00000216907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052560
AA Change: T76A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063109
Gene: ENSMUSG00000044286
AA Change: T76A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-51 PFAM
Pfam:7tm_1 41 290 3.1e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214071
AA Change: T76A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214342
AA Change: T76A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216188
AA Change: T76A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216907
AA Change: T76A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.3775 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Olfr221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02559:Olfr221 APN 14 52036007 missense probably damaging 1.00
G4846:Olfr221 UTSW 14 52035977 missense probably benign 0.00
R0077:Olfr221 UTSW 14 52035985 missense possibly damaging 0.94
R4762:Olfr221 UTSW 14 52035464 missense possibly damaging 0.85
R5209:Olfr221 UTSW 14 52035953 missense probably benign
R6225:Olfr221 UTSW 14 52035368 missense possibly damaging 0.55
R6492:Olfr221 UTSW 14 52035445 missense probably benign 0.01
R7412:Olfr221 UTSW 14 52035853 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGAGAGGCACAGACATTG -3'
(R):5'- GTTTGAACTCTTGGGCCTCACC -3'

Sequencing Primer
(F):5'- CATTGGGAGACACTATGGTCG -3'
(R):5'- TCTTGGGCCTCACCAGTGAC -3'
Posted On2016-07-06