Mutagenetix > Incidental Mutations

Incidental Mutation 'R0414:Suox'

40174

Institutional Source

Beutler Lab

Gene Symbol

Suox

Ensembl Gene

ENSMUSG00000049858

Gene Name

sulfite oxidase

Synonyms

MMRRC Submission

038616-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.397) question?

Stock #

R0414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128669894-128674073 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128671457 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 234 (H234L)

Ref Sequence

ENSEMBL: ENSMUSP00000056195 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054764]

Predicted Effect

probably benign
Transcript: ENSMUST00000054764
AA Change: H234L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000056195
Gene: ENSMUSG00000049858
AA Change: H234L

Domain	Start	End	E-Value	Type
low complexity region	58	70	N/A	INTRINSIC
Cyt-b5	86	162	3.41e-13	SMART
Pfam:Oxidored_molyb	220	396	1.2e-62	PFAM
Pfam:Mo-co_dimer	418	545	1.7e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217817

Meta Mutation Damage Score

0.0806

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	A	T	5: 103,649,490	V51E	probably benign	Het
4922502D21Rik	T	C	6: 129,326,850		probably benign	Het
Abo	T	C	2: 26,843,416	Y259C	probably damaging	Het
Adamts5	A	G	16: 85,877,906	S457P	probably damaging	Het
Alk	G	T	17: 71,899,286		probably benign	Het
Alpk2	A	G	18: 65,306,159	I1188T	probably benign	Het
Ambra1	T	C	2: 91,875,739	S730P	possibly damaging	Het
Arhgef2	T	C	3: 88,632,268		probably benign	Het
B3gnt7	T	C	1: 86,305,629	I82T	probably damaging	Het
B4galnt3	T	C	6: 120,216,565	D400G	probably benign	Het
Bag4	A	G	8: 25,767,997	V434A	possibly damaging	Het
BC055324	T	C	1: 163,968,321	I434V	probably benign	Het
Cfc1	A	G	1: 34,537,328	D130G	probably damaging	Het
Chd4	T	C	6: 125,107,480	Y692H	probably damaging	Het
Cilp2	A	G	8: 69,882,993	S452P	probably benign	Het
Crybg2	GAGAAGAAG	GAGAAG	4: 134,072,636		probably benign	Het
Dnah2	T	C	11: 69,499,238	D727G	probably benign	Het
Dock10	C	A	1: 80,535,933	V1129F	possibly damaging	Het
Dsc1	A	T	18: 20,088,354	I688N	possibly damaging	Het
Dyrk1a	C	G	16: 94,663,842	T103R	probably damaging	Het
Ebf1	C	T	11: 44,924,470	R304*	probably null	Het
Eif2s2	A	G	2: 154,884,461		probably benign	Het
Endov	T	G	11: 119,499,571	Y8*	probably null	Het
Eps15	T	A	4: 109,366,480	D485E	probably damaging	Het
Fam118a	C	A	15: 85,045,689	S39R	probably damaging	Het
Fam173b	T	A	15: 31,617,002	Y126*	probably null	Het
Fbxo22	T	A	9: 55,223,626	M393K	possibly damaging	Het
Gab1	A	G	8: 80,800,289	I60T	probably damaging	Het
Gapvd1	A	G	2: 34,693,427	L1059P	probably benign	Het
Gbp5	A	G	3: 142,507,913		probably null	Het
Glb1l2	T	A	9: 26,765,104	K487*	probably null	Het
Hist1h1a	A	G	13: 23,764,158		probably benign	Het
Hmcn1	T	C	1: 150,715,822	I1875M	possibly damaging	Het
Jkamp	T	C	12: 72,094,145		probably null	Het
Kprp	C	T	3: 92,825,713	C10Y	probably damaging	Het
Lrig2	A	G	3: 104,494,056		probably null	Het
Lrrn3	T	A	12: 41,453,940	N126I	probably damaging	Het
Mug1	T	C	6: 121,856,554	F325L	probably benign	Het
Myadm	AC	ACC	7: 3,296,760		probably null	Het
Nagk	C	T	6: 83,797,267	R87*	probably null	Het
Nipal4	T	A	11: 46,161,908	I77F	probably damaging	Het
Olfr1217	A	G	2: 89,023,146	Y286H	probably damaging	Het
Osbp2	T	C	11: 3,819,932	H250R	probably damaging	Het
Pcx	T	C	19: 4,607,642	V378A	possibly damaging	Het
Pfkp	T	A	13: 6,593,210	H524L	probably benign	Het
Picalm	A	T	7: 90,189,198	N370I	possibly damaging	Het
Plcl2	A	C	17: 50,607,955	D664A	possibly damaging	Het
Ptpn5	G	A	7: 47,083,136	P320S	probably benign	Het
Scn3a	T	A	2: 65,525,982		probably benign	Het
Sfswap	A	G	5: 129,504,051	D96G	possibly damaging	Het
Slfn1	A	G	11: 83,121,270	I71V	probably benign	Het
Spata1	A	G	3: 146,476,188		probably null	Het
Stx18	T	C	5: 38,105,005		probably benign	Het
Tbc1d17	T	C	7: 44,846,059	S114G	probably benign	Het
Tfeb	T	A	17: 47,788,299		probably null	Het
Tnks	A	C	8: 34,853,309	V736G	probably damaging	Het
Wdhd1	T	C	14: 47,276,588	T4A	probably benign	Het
Wdr66	A	G	5: 123,287,413		probably null	Het

Other mutations in Suox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02141:Suox	APN	10	128672098	splice site	probably benign
IGL02744:Suox	APN	10	128671217	missense	probably benign	0.00
PIT4402001:Suox	UTSW	10	128671295	missense	probably damaging	1.00
R0418:Suox	UTSW	10	128670885	missense	probably damaging	1.00
R0612:Suox	UTSW	10	128670656	missense	probably benign
R1845:Suox	UTSW	10	128670539	missense	possibly damaging	0.56
R3976:Suox	UTSW	10	128671037	missense	probably damaging	0.96
R4808:Suox	UTSW	10	128671889	missense	possibly damaging	0.81
R5098:Suox	UTSW	10	128671158	missense	probably damaging	1.00
R5587:Suox	UTSW	10	128671825	missense	probably damaging	1.00
R5721:Suox	UTSW	10	128671293	missense	possibly damaging	0.55
R6968:Suox	UTSW	10	128671833	missense	possibly damaging	0.92
R7378:Suox	UTSW	10	128671041	missense	probably benign	0.05
R7669:Suox	UTSW	10	128670911	missense	probably benign	0.01
R8345:Suox	UTSW	10	128671331	missense	probably benign	0.01
R8478:Suox	UTSW	10	128671052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGATGCTCCATAGGCAGTTCCAG -3'
(R):5'- TGAACCCCGAAGATAGCATGTCCC -3'

Sequencing Primer
(F):5'- CAGTGGGGTCTGAATCCAGTC -3'
(R):5'- GTGGAAGCCTCTGACCCTTATG -3'

Posted On

2013-05-23