Incidental Mutation 'R5227:Ireb2'
ID402684
Institutional Source Beutler Lab
Gene Symbol Ireb2
Ensembl Gene ENSMUSG00000032293
Gene Nameiron responsive element binding protein 2
SynonymsD9Ertd85e, Irp2
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54863789-54912530 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 54896601 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034843] [ENSMUST00000034843] [ENSMUST00000034843]
Predicted Effect probably null
Transcript: ENSMUST00000034843
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034843
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034843
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214023
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Ireb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ireb2 APN 9 54899482 splice site probably benign
IGL01576:Ireb2 APN 9 54892510 missense probably damaging 1.00
IGL01844:Ireb2 APN 9 54865357 missense probably benign 0.01
tony_stark UTSW 9 54903961 missense probably damaging 1.00
R0143:Ireb2 UTSW 9 54885909 missense probably benign 0.06
R0279:Ireb2 UTSW 9 54886593 missense probably benign
R0400:Ireb2 UTSW 9 54896498 missense probably benign
R0565:Ireb2 UTSW 9 54899983 missense probably damaging 1.00
R0686:Ireb2 UTSW 9 54904176 missense probably benign 0.44
R0706:Ireb2 UTSW 9 54892486 missense probably benign
R0894:Ireb2 UTSW 9 54896577 missense probably damaging 1.00
R1101:Ireb2 UTSW 9 54909702 missense probably benign 0.35
R1680:Ireb2 UTSW 9 54881518 missense probably damaging 1.00
R2074:Ireb2 UTSW 9 54881449 missense probably benign
R2080:Ireb2 UTSW 9 54896552 missense possibly damaging 0.85
R2891:Ireb2 UTSW 9 54899990 missense probably benign 0.01
R3153:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3154:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3844:Ireb2 UTSW 9 54892505 missense probably damaging 0.99
R4128:Ireb2 UTSW 9 54881432 missense probably benign 0.32
R4803:Ireb2 UTSW 9 54906814 missense probably benign 0.01
R5097:Ireb2 UTSW 9 54895384 missense probably benign 0.04
R5159:Ireb2 UTSW 9 54892547 missense probably benign
R5767:Ireb2 UTSW 9 54900516 missense probably benign
R6005:Ireb2 UTSW 9 54908805 missense probably damaging 1.00
R6127:Ireb2 UTSW 9 54882368 missense probably benign
R6155:Ireb2 UTSW 9 54886527 missense probably damaging 1.00
R6170:Ireb2 UTSW 9 54887372 missense probably benign 0.00
R6341:Ireb2 UTSW 9 54908780 missense probably damaging 0.99
R6707:Ireb2 UTSW 9 54903961 missense probably damaging 1.00
R6973:Ireb2 UTSW 9 54882387 missense probably benign 0.00
R7108:Ireb2 UTSW 9 54906641 missense probably damaging 1.00
R7126:Ireb2 UTSW 9 54886567 nonsense probably null
R7314:Ireb2 UTSW 9 54892510 missense probably damaging 1.00
R7396:Ireb2 UTSW 9 54882333 missense possibly damaging 0.83
R7472:Ireb2 UTSW 9 54884054 missense probably benign 0.11
R7590:Ireb2 UTSW 9 54896495 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGTCCAAGTTGTGTTTCCTAC -3'
(R):5'- CAGTAATTCTCCCCTTGCACAG -3'

Sequencing Primer
(F):5'- GTCCTACCAAGTCTGTAATATTTGC -3'
(R):5'- AGTAATTCTCCCCTTGCACAGTATAC -3'
Posted On2016-07-22