Incidental Mutation 'R5217:Stam2'
ID403511
Institutional Source Beutler Lab
Gene Symbol Stam2
Ensembl Gene ENSMUSG00000055371
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 2
SynonymsHbp, 1200004O12Rik, 5730456G07Rik
MMRRC Submission 042790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5217 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52691664-52742281 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 52736293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102759] [ENSMUST00000127316] [ENSMUST00000138290] [ENSMUST00000155516]
Predicted Effect probably benign
Transcript: ENSMUST00000102759
SMART Domains Protein: ENSMUSP00000099820
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
VHS 9 140 6.36e-57 SMART
UIM 165 184 3.24e-3 SMART
SH3 205 260 5.69e-21 SMART
Pfam:GAT 294 367 2.3e-8 PFAM
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127316
SMART Domains Protein: ENSMUSP00000121898
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
Pfam:VHS 4 70 8.5e-20 PFAM
UIM 132 151 3.24e-3 SMART
SH3 172 227 5.69e-21 SMART
PDB:3F1I|C 258 334 4e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138290
SMART Domains Protein: ENSMUSP00000114620
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
Pfam:VHS 1 65 7.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150582
Predicted Effect unknown
Transcript: ENSMUST00000155516
AA Change: P23S
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal lymphocyte responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Stam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Stam2 APN 2 52706406 missense possibly damaging 0.80
IGL00471:Stam2 APN 2 52720935 missense probably damaging 1.00
IGL01480:Stam2 APN 2 52716439 missense probably benign
IGL01731:Stam2 APN 2 52708150 missense probably damaging 0.99
IGL02684:Stam2 APN 2 52719935 missense probably damaging 1.00
IGL02893:Stam2 APN 2 52714902 missense probably damaging 1.00
IGL02900:Stam2 APN 2 52708197 missense probably benign
R0110:Stam2 UTSW 2 52719986 splice site probably benign
R0257:Stam2 UTSW 2 52694782 missense possibly damaging 0.90
R0539:Stam2 UTSW 2 52703256 splice site probably benign
R1432:Stam2 UTSW 2 52714809 splice site probably benign
R1699:Stam2 UTSW 2 52703175 missense possibly damaging 0.55
R1822:Stam2 UTSW 2 52716527 missense probably damaging 1.00
R1956:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R1984:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1985:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1986:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1993:Stam2 UTSW 2 52703156 nonsense probably null
R2179:Stam2 UTSW 2 52694924 missense probably benign 0.00
R2181:Stam2 UTSW 2 52703144 missense probably benign 0.00
R4617:Stam2 UTSW 2 52715704 missense probably benign 0.00
R4723:Stam2 UTSW 2 52720950 missense probably benign 0.10
R5218:Stam2 UTSW 2 52736293 intron probably benign
R5219:Stam2 UTSW 2 52736293 intron probably benign
R5366:Stam2 UTSW 2 52736293 intron probably benign
R5368:Stam2 UTSW 2 52736293 intron probably benign
R5420:Stam2 UTSW 2 52736293 intron probably benign
R5447:Stam2 UTSW 2 52736293 intron probably benign
R5490:Stam2 UTSW 2 52720917 missense probably damaging 1.00
R5799:Stam2 UTSW 2 52720910 nonsense probably null
R5861:Stam2 UTSW 2 52742104 utr 5 prime probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6490:Stam2 UTSW 2 52720942 missense probably benign 0.00
R6552:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R6792:Stam2 UTSW 2 52707981 missense probably benign
R7787:Stam2 UTSW 2 52706406 missense probably benign 0.01
R8042:Stam2 UTSW 2 52706397 critical splice donor site probably null
R8050:Stam2 UTSW 2 52719773 missense probably damaging 1.00
R8074:Stam2 UTSW 2 52706426 missense probably damaging 0.98
R8245:Stam2 UTSW 2 52714919 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ACTAGCCAGGGTTATGAGGG -3'
(R):5'- ACTGATAGCTCTTAGCCATTTGTTG -3'

Sequencing Primer
(F):5'- TGGCCGTGCAAAAACACTTTG -3'
(R):5'- AGCTCTTAGCCATTTGTTGTCTGTAC -3'
Posted On2016-07-22