Incidental Mutation 'R5275:Atp5c1'
ID403861
Institutional Source Beutler Lab
Gene Symbol Atp5c1
Ensembl Gene ENSMUSG00000025781
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
SynonymsF1 gamma, 1700094F02Rik
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location10056016-10080510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10068733 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 10 (R10G)
Ref Sequence ENSEMBL: ENSMUSP00000116368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026887] [ENSMUST00000114896] [ENSMUST00000114897] [ENSMUST00000130067] [ENSMUST00000139810] [ENSMUST00000145530] [ENSMUST00000153554]
Predicted Effect probably benign
Transcript: ENSMUST00000026887
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026887
Gene: ENSMUSG00000025781
AA Change: R34G

DomainStartEndE-ValueType
Pfam:ATP-synt 26 297 1.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114896
AA Change: R10G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110546
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 273 1.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114897
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110547
Gene: ENSMUSG00000025781
AA Change: R34G

DomainStartEndE-ValueType
Pfam:ATP-synt 27 297 6.8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130067
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117182
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 101 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139810
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123100
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 153 6.1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145530
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116508
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 187 1.2e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153554
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116368
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 171 1.2e-43 PFAM
Meta Mutation Damage Score 0.9369 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Atp5c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Atp5c1 APN 2 10068666 missense probably damaging 1.00
R3106:Atp5c1 UTSW 2 10063465 missense probably benign 0.35
R4651:Atp5c1 UTSW 2 10063476 missense probably damaging 1.00
R4670:Atp5c1 UTSW 2 10059617 missense probably damaging 1.00
R5097:Atp5c1 UTSW 2 10063512 missense probably benign 0.01
R5295:Atp5c1 UTSW 2 10068733 missense possibly damaging 0.51
R6195:Atp5c1 UTSW 2 10064115 missense possibly damaging 0.79
R6536:Atp5c1 UTSW 2 10080316 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCATGTCGTCTCTGCCC -3'
(R):5'- CATGCCATGTCCTAAGTAGCAAGT -3'

Sequencing Primer
(F):5'- GCATACTTTGCAGCTGC -3'
(R):5'- AAGTCTTGCTTCTTGATGGCTAC -3'
Posted On2016-07-22