Incidental Mutation 'R5300:Ly86'
ID405615
Institutional Source Beutler Lab
Gene Symbol Ly86
Ensembl Gene ENSMUSG00000021423
Gene Namelymphocyte antigen 86
SynonymsMD-1, MD1
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location37345208-37419036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37418612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 160 (T160I)
Ref Sequence ENSEMBL: ENSMUSP00000021860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021860]
PDB Structure
Crystal structure of mouse MD-1 in complex with phosphatidylcholine [X-RAY DIFFRACTION]
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021860
AA Change: T160I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021860
Gene: ENSMUSG00000021423
AA Change: T160I

DomainStartEndE-ValueType
ML 42 159 4.29e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190684
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display impaired LPS-induced B-cell proliferation and antibody production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Ly86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02693:Ly86 APN 13 37375029 missense probably damaging 1.00
R0082:Ly86 UTSW 13 37418537 critical splice acceptor site probably null
R4605:Ly86 UTSW 13 37375011 missense possibly damaging 0.81
R4642:Ly86 UTSW 13 37376901 missense possibly damaging 0.53
R4665:Ly86 UTSW 13 37375034 missense probably damaging 0.98
R4904:Ly86 UTSW 13 37415520 missense possibly damaging 0.94
R5112:Ly86 UTSW 13 37375037 missense probably damaging 1.00
R7145:Ly86 UTSW 13 37377010 missense probably damaging 1.00
R7258:Ly86 UTSW 13 37345497 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGGTTCAGTACAGAAACTTCTTG -3'
(R):5'- TCTGGGAACATCTGTCCCTG -3'

Sequencing Primer
(F):5'- GGTGGGCAGATACACAATCCTTG -3'
(R):5'- GAACATCTGTCCCTGGAGCTAAG -3'
Posted On2016-07-22