Incidental Mutation 'R5300:AF529169'
ID405606
Institutional Source Beutler Lab
Gene Symbol AF529169
Ensembl Gene ENSMUSG00000039313
Gene NamecDNA sequence AF529169
SynonymsDD1
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89587216-89623125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89603199 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 48 (S48R)
Ref Sequence ENSEMBL: ENSMUSP00000140942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044491] [ENSMUST00000191465]
Predicted Effect probably damaging
Transcript: ENSMUST00000044491
AA Change: S48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046111
Gene: ENSMUSG00000039313
AA Change: S48R

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 760 915 8.7e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191465
AA Change: S48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140942
Gene: ENSMUSG00000039313
AA Change: S48R

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 759 854 6.1e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in AF529169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:AF529169 APN 9 89601800 missense probably benign 0.02
IGL00163:AF529169 APN 9 89591097 unclassified probably benign
IGL00336:AF529169 APN 9 89603143 missense probably damaging 1.00
IGL01608:AF529169 APN 9 89596498 missense probably benign 0.15
IGL01818:AF529169 APN 9 89601313 missense probably damaging 0.99
IGL02012:AF529169 APN 9 89601438 missense probably benign 0.01
IGL02259:AF529169 APN 9 89602359 missense possibly damaging 0.93
IGL02894:AF529169 APN 9 89603102 missense probably damaging 0.99
IGL03008:AF529169 APN 9 89596678 missense probably damaging 1.00
IGL02988:AF529169 UTSW 9 89602739 missense probably benign 0.02
R0410:AF529169 UTSW 9 89602203 missense probably damaging 0.97
R0825:AF529169 UTSW 9 89603279 nonsense probably null
R0883:AF529169 UTSW 9 89602417 missense probably benign 0.05
R0989:AF529169 UTSW 9 89602035 missense probably damaging 0.99
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1632:AF529169 UTSW 9 89602360 missense probably damaging 0.96
R1804:AF529169 UTSW 9 89603099 missense possibly damaging 0.91
R1974:AF529169 UTSW 9 89601203 missense probably damaging 1.00
R2151:AF529169 UTSW 9 89602168 missense possibly damaging 0.53
R2882:AF529169 UTSW 9 89602802 missense possibly damaging 0.86
R2909:AF529169 UTSW 9 89591278 missense probably damaging 1.00
R3961:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3962:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3963:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R4676:AF529169 UTSW 9 89601553 missense probably damaging 1.00
R4778:AF529169 UTSW 9 89603102 missense probably damaging 1.00
R4931:AF529169 UTSW 9 89601652 missense probably benign 0.05
R5702:AF529169 UTSW 9 89591155 missense probably benign 0.22
R5759:AF529169 UTSW 9 89601072 missense probably benign 0.01
R6187:AF529169 UTSW 9 89591167 missense probably damaging 1.00
R7320:AF529169 UTSW 9 89601626 missense probably benign
R7542:AF529169 UTSW 9 89601911 missense probably damaging 1.00
R7552:AF529169 UTSW 9 89601835 missense probably benign 0.00
U24488:AF529169 UTSW 9 89603047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGACTCAAAGGATGCTTCC -3'
(R):5'- TGCAGTGTAGTCAGTAAGCTTG -3'

Sequencing Primer
(F):5'- GCACCTTGTGGCAACTCATG -3'
(R):5'- GCTTGCACATCTAAATCATGGAGGC -3'
Posted On2016-07-22