Incidental Mutation 'R5300:Lgr6'
ID405594
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134994010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000122334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Meta Mutation Damage Score 0.1650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
R7699:Lgr6 UTSW 1 134996032
R7700:Lgr6 UTSW 1 134996032
R7734:Lgr6 UTSW 1 135003243
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTTCCTTCGGGGTCACAAG -3'
(R):5'- TCAGGAATCAGGCTTCAAGATTCC -3'

Sequencing Primer
(F):5'- GTCACAAGGATCCCTACTAATACTTC -3'
(R):5'- TTATGGTTGCAAGTCACCACAGC -3'
Posted On2016-07-22