Incidental Mutation 'R5350:Abca9'
ID423769
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission 042929-MU
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110115538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1247 (V1247A)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably benign
Transcript: ENSMUST00000044850
AA Change: V1247A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: V1247A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atg2a T A 19: 6,251,338 V814E probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Cops4 T A 5: 100,518,539 D21E possibly damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Disp2 A G 2: 118,787,575 T201A probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Evi5 C T 5: 107,815,678 D344N probably benign Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1246 T A 2: 89,591,088 E9V possibly damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Tmprss11d T C 5: 86,338,887 Y48C probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6675:Abca9 UTSW 11 110115476 missense probably benign
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
R7390:Abca9 UTSW 11 110145661 missense probably benign 0.01
R7429:Abca9 UTSW 11 110127426 frame shift probably null
R7431:Abca9 UTSW 11 110127426 frame shift probably null
R7621:Abca9 UTSW 11 110160533 missense probably benign 0.00
R7623:Abca9 UTSW 11 110107558 missense probably benign 0.27
R7660:Abca9 UTSW 11 110115452 missense probably benign
R7784:Abca9 UTSW 11 110154417 nonsense probably null
R7798:Abca9 UTSW 11 110138179 missense probably benign 0.45
R7839:Abca9 UTSW 11 110134259 missense probably benign 0.43
R7891:Abca9 UTSW 11 110163272 missense probably benign 0.03
R7894:Abca9 UTSW 11 110106589 missense possibly damaging 0.49
R8030:Abca9 UTSW 11 110120708 missense probably benign
R8133:Abca9 UTSW 11 110127463 missense possibly damaging 0.88
R8195:Abca9 UTSW 11 110138329 missense probably benign 0.01
R8304:Abca9 UTSW 11 110107128 critical splice donor site probably null
R8386:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R8390:Abca9 UTSW 11 110145630 missense probably benign 0.01
Z1176:Abca9 UTSW 11 110135375 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCAGCAGGCCTTTAAGAGAATC -3'
(R):5'- TGACAGAGGATGTGTGCTGC -3'

Sequencing Primer
(F):5'- GAATCAAGATGGGAACGTTTCTC -3'
(R):5'- TGGCATCACCTAATTAGGAGAC -3'
Posted On2016-08-04