Incidental Mutation 'R5359:Erp44'
ID424226
Institutional Source Beutler Lab
Gene Symbol Erp44
Ensembl Gene ENSMUSG00000028343
Gene Nameendoplasmic reticulum protein 44
Synonyms1110001E24Rik, Txndc4
MMRRC Submission 042938-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5359 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48193323-48279558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48211704 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 197 (D197E)
Ref Sequence ENSEMBL: ENSMUSP00000030028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030028]
Predicted Effect probably benign
Transcript: ENSMUST00000030028
AA Change: D197E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030028
Gene: ENSMUSG00000028343
AA Change: D197E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:Calsequestrin 29 205 6.4e-12 PFAM
Pfam:Thioredoxin 30 139 1.1e-23 PFAM
Pfam:Thioredoxin_6 167 350 8.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157219
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. It has an inferred N-terminal signal peptide, a catalytically active thioredoxin (TRX) domain, two TRX-like domains and a C-terminal ER-retention sequence. This protein functions as a pH-regulated chaperone of the secretory pathway and likely plays a role in protein quality control at the endoplasmic reticulum - Golgi interface. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit light coat colour, small stature and scaly tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5b1 T A 19: 5,569,098 I182N possibly damaging Het
Arap2 A T 5: 62,683,419 C701* probably null Het
Bcr T A 10: 75,166,085 F940L probably damaging Het
Casc1 T G 6: 145,196,892 T120P probably damaging Het
Cav2 A T 6: 17,287,065 probably benign Het
Cdk2 T C 10: 128,703,988 probably benign Het
Clic4 G A 4: 135,217,135 A243V probably benign Het
Dap3 A T 3: 88,930,989 V99D probably damaging Het
Dennd5a T C 7: 109,897,962 E1110G probably damaging Het
Dhx30 T C 9: 110,093,135 N160D probably damaging Het
Dock9 A G 14: 121,653,060 M268T possibly damaging Het
Dspp T A 5: 104,175,886 D298E probably damaging Het
Elane A G 10: 79,887,036 E92G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbf1 T C 19: 46,283,725 probably null Het
Gm1968 A T 16: 29,958,799 noncoding transcript Het
Hydin T A 8: 110,538,372 V2729E probably benign Het
Iqgap1 T C 7: 80,766,959 T106A probably benign Het
Kcnj6 G C 16: 94,832,453 Y248* probably null Het
Mllt3 A G 4: 87,840,927 S295P probably benign Het
Olfr1369-ps1 A C 13: 21,116,267 T192P probably damaging Het
Pex11b G A 3: 96,643,913 C224Y probably damaging Het
Pik3c2g A G 6: 139,622,123 Y79C probably damaging Het
Plcz1 T C 6: 140,028,452 Y88C probably damaging Het
Pole A G 5: 110,332,488 N99S probably benign Het
Pyroxd1 T G 6: 142,361,991 Y496D probably damaging Het
Rasef A G 4: 73,771,328 L68P probably damaging Het
Rgs13 T A 1: 144,139,584 M132L probably damaging Het
RP24-187P11.4 T G 9: 109,520,876 noncoding transcript Het
Rsph4a A G 10: 33,908,236 T285A probably benign Het
Ryr3 A T 2: 112,775,841 probably null Het
Slc30a1 T A 1: 191,909,753 *504R probably null Het
Spcs1 T C 14: 31,000,117 R156G probably damaging Het
Supv3l1 A G 10: 62,432,399 F556L probably damaging Het
Thumpd2 C T 17: 81,026,777 V461M probably benign Het
Timm50 A G 7: 28,308,167 L158P probably damaging Het
Tnrc6c T C 11: 117,758,905 silent Het
Ttn G A 2: 76,895,803 Q1807* probably null Het
Zdhhc14 A G 17: 5,493,546 I34V probably benign Het
Zgrf1 T A 3: 127,601,165 M506K possibly damaging Het
Other mutations in Erp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Erp44 APN 4 48218126 missense probably benign 0.22
IGL02057:Erp44 APN 4 48236964 missense probably benign 0.05
IGL03165:Erp44 APN 4 48236872 critical splice donor site probably null
IGL03253:Erp44 APN 4 48208750 missense probably benign 0.09
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R4976:Erp44 UTSW 4 48208797 missense probably benign 0.01
R5024:Erp44 UTSW 4 48241296 nonsense probably null
R5175:Erp44 UTSW 4 48196823 missense probably benign 0.41
R5224:Erp44 UTSW 4 48279435 missense probably benign
R6128:Erp44 UTSW 4 48243493 missense probably damaging 0.98
R6248:Erp44 UTSW 4 48219479 nonsense probably null
R6649:Erp44 UTSW 4 48205130 missense probably null 0.01
R6653:Erp44 UTSW 4 48205130 missense probably null 0.01
R6911:Erp44 UTSW 4 48204268 missense probably benign 0.17
R7061:Erp44 UTSW 4 48219375 missense probably benign
R7209:Erp44 UTSW 4 48211704 missense probably benign
R7291:Erp44 UTSW 4 48208792 missense probably damaging 1.00
R7369:Erp44 UTSW 4 48218183 missense probably benign
R7703:Erp44 UTSW 4 48196904 missense probably benign 0.09
R7785:Erp44 UTSW 4 48243531 missense probably benign 0.04
R7992:Erp44 UTSW 4 48218136 missense possibly damaging 0.57
R8213:Erp44 UTSW 4 48208783 missense probably benign 0.03
R8332:Erp44 UTSW 4 48243475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTGCGTCACTCTGAAATAC -3'
(R):5'- GCCTTTAAATGTATGCTTGTCTTGC -3'

Sequencing Primer
(F):5'- TGGCATACACAAGCCTTTGG -3'
(R):5'- ATGCTTGTCTTGCTATTGTACAG -3'
Posted On2016-08-04