Incidental Mutation 'R6653:Erp44'
ID526501
Institutional Source Beutler Lab
Gene Symbol Erp44
Ensembl Gene ENSMUSG00000028343
Gene Nameendoplasmic reticulum protein 44
Synonyms1110001E24Rik, Txndc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location48193323-48279558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48205130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 288 (I288V)
Ref Sequence ENSEMBL: ENSMUSP00000030028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030028]
Predicted Effect probably null
Transcript: ENSMUST00000030028
AA Change: I288V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030028
Gene: ENSMUSG00000028343
AA Change: I288V

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:Calsequestrin 29 205 6.4e-12 PFAM
Pfam:Thioredoxin 30 139 1.1e-23 PFAM
Pfam:Thioredoxin_6 167 350 8.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. It has an inferred N-terminal signal peptide, a catalytically active thioredoxin (TRX) domain, two TRX-like domains and a C-terminal ER-retention sequence. This protein functions as a pH-regulated chaperone of the secretory pathway and likely plays a role in protein quality control at the endoplasmic reticulum - Golgi interface. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit light coat colour, small stature and scaly tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Erp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Erp44 APN 4 48218126 missense probably benign 0.22
IGL02057:Erp44 APN 4 48236964 missense probably benign 0.05
IGL03165:Erp44 APN 4 48236872 critical splice donor site probably null
IGL03253:Erp44 APN 4 48208750 missense probably benign 0.09
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R4976:Erp44 UTSW 4 48208797 missense probably benign 0.01
R5024:Erp44 UTSW 4 48241296 nonsense probably null
R5175:Erp44 UTSW 4 48196823 missense probably benign 0.41
R5224:Erp44 UTSW 4 48279435 missense probably benign
R5359:Erp44 UTSW 4 48211704 missense probably benign
R6128:Erp44 UTSW 4 48243493 missense probably damaging 0.98
R6248:Erp44 UTSW 4 48219479 nonsense probably null
R6649:Erp44 UTSW 4 48205130 missense probably null 0.01
R6911:Erp44 UTSW 4 48204268 missense probably benign 0.17
R7061:Erp44 UTSW 4 48219375 missense probably benign
R7209:Erp44 UTSW 4 48211704 missense probably benign
R7291:Erp44 UTSW 4 48208792 missense probably damaging 1.00
R7369:Erp44 UTSW 4 48218183 missense probably benign
R7703:Erp44 UTSW 4 48196904 missense probably benign 0.09
R7785:Erp44 UTSW 4 48243531 missense probably benign 0.04
R7992:Erp44 UTSW 4 48218136 missense possibly damaging 0.57
R8213:Erp44 UTSW 4 48208783 missense probably benign 0.03
R8332:Erp44 UTSW 4 48243475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTACAGTTCGCCCAGAAGCC -3'
(R):5'- GTTGTATGAATTGAGTCCACACTTG -3'

Sequencing Primer
(F):5'- AGAAGCCCGCTCTTCATG -3'
(R):5'- ATGAATTGAGTCCACACTTGTTCCAC -3'
Posted On2018-07-23