Incidental Mutation 'R5289:Plag1'
ID424578
Institutional Source Beutler Lab
Gene Symbol Plag1
Ensembl Gene ENSMUSG00000003282
Gene Namepleiomorphic adenoma gene 1
Synonyms
MMRRC Submission 042872-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R5289 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location3900996-3938423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3905545 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 48 (K48N)
Ref Sequence ENSEMBL: ENSMUSP00000003369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003369] [ENSMUST00000137439] [ENSMUST00000151543]
Predicted Effect probably damaging
Transcript: ENSMUST00000003369
AA Change: K48N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003369
Gene: ENSMUSG00000003282
AA Change: K48N

DomainStartEndE-ValueType
ZnF_C2H2 34 56 2.2e-2 SMART
ZnF_C2H2 62 86 1.6e-4 SMART
ZnF_C2H2 92 114 1.89e-1 SMART
ZnF_C2H2 121 143 5.99e-4 SMART
ZnF_C2H2 150 172 2.86e-1 SMART
ZnF_C2H2 185 207 1.03e-2 SMART
ZnF_C2H2 213 236 8.94e-3 SMART
low complexity region 364 379 N/A INTRINSIC
low complexity region 396 411 N/A INTRINSIC
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137439
Predicted Effect probably benign
Transcript: ENSMUST00000151543
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced male fertility, small seminal vesicles and ventral prostate, reduced litter size (females only), reduced embryonic and postnatal growth, and delayed eyelid opening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 37,000,109 Q3126K probably damaging Het
Adgrv1 A G 13: 81,521,084 V1731A probably benign Het
Ahcyl1 A G 3: 107,669,890 probably null Het
Aox1 T A 1: 58,092,558 M1042K probably damaging Het
Atp10d C A 5: 72,255,123 Q590K probably benign Het
Atp8b1 G T 18: 64,546,087 N774K possibly damaging Het
Atrnl1 C T 19: 57,657,082 T458M probably damaging Het
BC005561 G A 5: 104,519,657 V682I probably benign Het
Cnr1 T A 4: 33,943,910 C99* probably null Het
Cnr2 A G 4: 135,917,007 Y132C probably damaging Het
Commd9 C T 2: 101,898,894 A115V probably benign Het
Diaph3 A G 14: 86,981,678 F426S probably damaging Het
Diras1 G A 10: 81,022,244 Q58* probably null Het
Dpy19l2 A G 9: 24,695,997 L56P probably benign Het
Dsc1 A T 18: 20,101,853 V248D possibly damaging Het
Frem3 A G 8: 80,612,319 M414V probably benign Het
Frmd4b G T 6: 97,302,348 probably null Het
Gabarapl2 T C 8: 111,942,595 W62R probably damaging Het
Glt1d1 A G 5: 127,644,356 R36G probably benign Het
Grb10 T C 11: 11,944,924 silent Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc A G 2: 34,996,014 probably null Het
Hgd A G 16: 37,628,551 E379G possibly damaging Het
Ifi30 A T 8: 70,766,601 probably benign Het
Iqgap1 T C 7: 80,738,724 I842V possibly damaging Het
Iqsec3 T A 6: 121,386,700 probably null Het
Kalrn A G 16: 34,252,341 S724P possibly damaging Het
Lama2 C A 10: 27,212,073 G903* probably null Het
Lrrc10 T C 10: 117,045,487 V22A probably benign Het
Lzts3 T C 2: 130,636,101 E245G probably benign Het
Man2a1 A G 17: 64,651,227 T246A probably damaging Het
Mfsd13a A G 19: 46,368,280 E240G probably benign Het
Mtor T C 4: 148,466,092 I735T possibly damaging Het
Naa15 A T 3: 51,455,894 H333L probably damaging Het
Nes C A 3: 87,978,418 T1284K probably damaging Het
Nexn T G 3: 152,248,072 H173P probably benign Het
Nid2 T C 14: 19,805,311 V1173A possibly damaging Het
Npepps A G 11: 97,240,927 probably null Het
Pgm2 T A 4: 99,967,069 M313K probably damaging Het
Pih1d3 A T 1: 31,223,527 I197F probably benign Het
Prok1 G C 3: 107,239,619 L11V probably benign Het
Ptpn9 T C 9: 57,060,063 probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc38a4 A T 15: 97,010,348 F171I possibly damaging Het
Sycp1 A T 3: 102,934,253 N78K possibly damaging Het
Tas2r110 T C 6: 132,868,009 M1T probably null Het
Tmem260 G A 14: 48,486,810 V182M possibly damaging Het
Tmem30a A T 9: 79,776,154 N144K probably damaging Het
Vmn2r108 A G 17: 20,471,604 L219P probably damaging Het
Vmn2r57 A G 7: 41,399,974 S784P probably damaging Het
Vwf T C 6: 125,667,510 probably benign Het
Wdr62 A C 7: 30,267,875 V318G probably damaging Het
Zfp398 T A 6: 47,863,181 S115T probably benign Het
Zfp62 T A 11: 49,217,148 C689S probably damaging Het
Zmynd15 C G 11: 70,466,004 P580R unknown Het
Other mutations in Plag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Plag1 APN 4 3904055 missense probably damaging 0.99
IGL01775:Plag1 APN 4 3904513 missense probably damaging 1.00
IGL02738:Plag1 APN 4 3903812 nonsense probably null
extracted UTSW 4 3904676 missense probably damaging 1.00
Rehab UTSW 4 3904546 missense probably damaging 1.00
scrawny UTSW 4 3905463 nonsense probably null
PIT4378001:Plag1 UTSW 4 3905492 missense probably benign 0.16
R0217:Plag1 UTSW 4 3904379 missense probably benign 0.05
R0359:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0554:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0892:Plag1 UTSW 4 3904532 nonsense probably null
R1541:Plag1 UTSW 4 3904085 missense probably benign
R1964:Plag1 UTSW 4 3903956 missense probably benign
R2011:Plag1 UTSW 4 3904889 missense probably damaging 1.00
R2012:Plag1 UTSW 4 3904870 missense probably damaging 1.00
R2126:Plag1 UTSW 4 3904169 missense possibly damaging 0.50
R3982:Plag1 UTSW 4 3904055 missense probably damaging 0.97
R4285:Plag1 UTSW 4 3905654 missense probably benign 0.13
R5244:Plag1 UTSW 4 3903887 missense probably benign 0.02
R5386:Plag1 UTSW 4 3904075 missense probably benign
R5428:Plag1 UTSW 4 3905538 missense possibly damaging 0.94
R5608:Plag1 UTSW 4 3905463 nonsense probably null
R5755:Plag1 UTSW 4 3904492 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6080:Plag1 UTSW 4 3903815 missense probably benign
R6296:Plag1 UTSW 4 3904499 missense probably damaging 1.00
R7038:Plag1 UTSW 4 3904676 missense probably damaging 1.00
R7116:Plag1 UTSW 4 3904812 nonsense probably null
R8435:Plag1 UTSW 4 3905648 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAACATTTCCTCTCTGCAAATCAGC -3'
(R):5'- TTCCCAGGTGTCCAACAAGAAG -3'

Sequencing Primer
(F):5'- TCTGCAAATCAGCTGAGAAATGTG -3'
(R):5'- TCCAACAAGAAGGCCTGGTTTAG -3'
Posted On2016-08-04