Incidental Mutation 'R5392:Acyp1'
List |< first << previous [record 2 of 41] next >> last >|
ID425916
Institutional Source Beutler Lab
Gene Symbol Acyp1
Ensembl Gene ENSMUSG00000008822
Gene Nameacylphosphatase 1, erythrocyte (common) type
Synonyms
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85272398-85288438 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 85278985 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000065913] [ENSMUST00000117138] [ENSMUST00000121930]
Predicted Effect probably benign
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000065913
AA Change: Q80R
SMART Domains Protein: ENSMUSP00000070555
Gene: ENSMUSG00000008822
AA Change: Q80R

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 35 5.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Acyp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1204:Acyp1 UTSW 12 85280092 splice site probably null
R1898:Acyp1 UTSW 12 85288340 missense probably benign 0.00
R4683:Acyp1 UTSW 12 85278943 intron probably benign
R5336:Acyp1 UTSW 12 85280011 missense probably damaging 1.00
R6747:Acyp1 UTSW 12 85278905 missense probably null
R7075:Acyp1 UTSW 12 85279008 missense unknown
R7746:Acyp1 UTSW 12 85279058 missense unknown
R7794:Acyp1 UTSW 12 85288279 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAGACGTTCTGACTCCGGAC -3'
(R):5'- TCCAAATTATCTGGAGTAGCACG -3'

Sequencing Primer
(F):5'- CACGTGGGTGCATCTACACATC -3'
(R):5'- TCCTTGTCTTATCACCAAGGAACAG -3'
Posted On2016-08-04