Incidental Mutation 'R5499:Olfr675'
ID 430516
Institutional Source Beutler Lab
Gene Symbol Olfr675
Ensembl Gene ENSMUSG00000096773
Gene Name olfactory receptor 675
Synonyms GA_x6K02T2PBJ9-7653782-7652841, MOR32-9P
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R5499 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 105021370-105028460 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 105024977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000149895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073102] [ENSMUST00000210113] [ENSMUST00000214318] [ENSMUST00000215899]
AlphaFold A0A1B0GSE1
Predicted Effect probably null
Transcript: ENSMUST00000073102
SMART Domains Protein: ENSMUSP00000072847
Gene: ENSMUSG00000096773

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.9e-6 PFAM
Pfam:7tm_1 43 293 2.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000210113
AA Change: M1K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably null
Transcript: ENSMUST00000214318
AA Change: M1K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably null
Transcript: ENSMUST00000215899
AA Change: M1K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,601,793 E74K unknown Het
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
Galnt17 T A 5: 130,900,628 Q447L probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Herpud1 C T 8: 94,389,413 L69F probably damaging Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr366 T C 2: 37,219,765 I92T possibly damaging Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Sgcb T C 5: 73,644,405 N39S probably damaging Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn8 C A 11: 83,004,216 S588I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in Olfr675
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02639:Olfr675 APN 7 105024222 missense probably damaging 1.00
IGL02944:Olfr675 APN 7 105024923 missense probably damaging 1.00
R1182:Olfr675 UTSW 7 105024078 missense probably damaging 1.00
R1412:Olfr675 UTSW 7 105024195 missense probably damaging 1.00
R1528:Olfr675 UTSW 7 105024764 missense probably damaging 1.00
R1555:Olfr675 UTSW 7 105024522 missense probably benign 0.00
R1589:Olfr675 UTSW 7 105024560 missense probably benign
R1778:Olfr675 UTSW 7 105024163 missense probably benign 0.03
R3690:Olfr675 UTSW 7 105024695 missense probably damaging 0.99
R3848:Olfr675 UTSW 7 105024332 missense probably damaging 0.99
R4784:Olfr675 UTSW 7 105024530 missense probably damaging 0.97
R5050:Olfr675 UTSW 7 105024387 missense probably damaging 1.00
R5074:Olfr675 UTSW 7 105024053 missense probably benign
R5586:Olfr675 UTSW 7 105024221 missense probably damaging 1.00
R7244:Olfr675 UTSW 7 105024941 missense probably benign
R8297:Olfr675 UTSW 7 105024678 missense probably benign 0.14
R8532:Olfr675 UTSW 7 105024566 missense probably damaging 1.00
R9087:Olfr675 UTSW 7 105024703 nonsense probably null
Z1176:Olfr675 UTSW 7 105024099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAGCATGGCTAGGAAGTAG -3'
(R):5'- CTGTGTGAAATTCAGGAAACTTGC -3'

Sequencing Primer
(F):5'- GGCTCATGAAGACTGTGTTCAG -3'
(R):5'- GTGAAATTCAGGAAACTTGCACATG -3'
Posted On 2016-10-05