Mutagenetix > Incidental Mutation

Incidental Mutation 'R5593:Sptlc2'

437648

Institutional Source

Beutler Lab

Gene Symbol

Sptlc2

Ensembl Gene

ENSMUSG00000021036

Gene Name

serine palmitoyltransferase, long chain base subunit 2

Synonyms

LCB2

MMRRC Submission

043145-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5593 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87305058-87388355 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 87369083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 57 (F57V)

Ref Sequence

ENSEMBL: ENSMUSP00000021424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021424]

AlphaFold

P97363

Predicted Effect

probably benign
Transcript: ENSMUST00000021424
AA Change: F57V

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036
AA Change: F57V

Domain	Start	End	E-Value	Type
Pfam:Aminotran_1_2	166	526	7.2e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221879

Meta Mutation Damage Score

0.0639

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	C	T	11: 3,938,027	V120I	unknown	Het
9330182L06Rik	T	A	5: 9,266,350	L27Q	probably benign	Het
Anpep	T	G	7: 79,842,046	K69T	probably benign	Het
Appbp2	A	T	11: 85,194,583	I499K	possibly damaging	Het
Copb2	A	G	9: 98,587,038		probably null	Het
Cpa5	T	C	6: 30,630,849	I370T	probably benign	Het
Cpn2	T	C	16: 30,260,080	T268A	probably benign	Het
Ctbp2	C	A	7: 132,998,869	R99I	possibly damaging	Het
Cul1	G	A	6: 47,485,086	W196*	probably null	Het
Cul1	T	C	6: 47,514,991	F402L	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
Dyrk1a	C	A	16: 94,659,583	Q33K	possibly damaging	Het
Epg5	T	A	18: 77,957,474	S542T	probably damaging	Het
Eps8l3	A	T	3: 107,891,188		probably benign	Het
Evc2	A	G	5: 37,386,977	H690R	probably damaging	Het
Fam227a	G	A	15: 79,640,058		probably benign	Het
Gadl1	G	T	9: 116,006,650	G382V	probably damaging	Het
Gbf1	A	G	19: 46,272,524	Q1176R	possibly damaging	Het
Gdf9	A	T	11: 53,433,731	H109L	probably damaging	Het
Gm7534	T	C	4: 134,193,039	K605R	probably damaging	Het
Gsdmd	T	A	15: 75,867,007	V411D	probably damaging	Het
Hdc	T	C	2: 126,618,584		probably benign	Het
Ifrd2	A	G	9: 107,590,175	D82G	probably damaging	Het
Itpkb	T	C	1: 180,334,096	S596P	probably damaging	Het
Kcnmb3	A	G	3: 32,491,947	V8A	possibly damaging	Het
Lyst	T	G	13: 13,743,333	I3326S	probably damaging	Het
Mcm9	G	A	10: 53,538,297	T229I	probably damaging	Het
Medag	T	A	5: 149,426,950	F21L	probably benign	Het
Mefv	A	T	16: 3,715,451	C319S	probably benign	Het
Mettl23	T	A	11: 116,843,767	V54D	probably damaging	Het
Mul1	A	G	4: 138,439,232	D199G	probably damaging	Het
Ncor1	A	T	11: 62,369,304	I266N	probably damaging	Het
Nek10	A	T	14: 14,980,544	K967*	probably null	Het
Nrcam	A	G	12: 44,559,700	T410A	probably damaging	Het
Olfr222	T	C	11: 59,571,048	R231G	possibly damaging	Het
Olfr59	A	G	11: 74,288,792	I49V	possibly damaging	Het
Olfr607	C	T	7: 103,460,385		silent	Het
Olfr677	T	C	7: 105,056,504	I86T	probably damaging	Het
Pate2	A	T	9: 35,670,482	D24V	possibly damaging	Het
Plcb3	T	C	19: 6,954,749	I1124V	possibly damaging	Het
Ptprc	A	T	1: 138,117,720		probably benign	Het
Rab6a	T	C	7: 100,608,171		probably benign	Het
Rnf208	G	T	2: 25,243,333	W13L	possibly damaging	Het
Rps6kl1	G	T	12: 85,146,901	Q139K	possibly damaging	Het
Sdk1	T	A	5: 141,956,124	I509N	probably damaging	Het
Sephs1	A	G	2: 4,893,287	I170V	probably benign	Het
Slc17a8	C	T	10: 89,606,840	D44N	probably benign	Het
Slc23a1	T	A	18: 35,622,296	I489F	probably damaging	Het
Slc25a19	A	T	11: 115,616,592	Y235N	probably damaging	Het
Slc47a2	A	G	11: 61,342,660	V40A	probably benign	Het
Slurp2	C	T	15: 74,743,068	V75I	probably benign	Het
Smc1b	A	C	15: 85,121,641	M354R	probably benign	Het
Spice1	C	A	16: 44,370,752	A323E	possibly damaging	Het
Sptbn2	T	A	19: 4,748,947	V2015E	probably damaging	Het
Srsf1	A	G	11: 88,047,879	N14S	possibly damaging	Het
Ssh2	T	A	11: 77,421,366	D228E	probably damaging	Het
Synj2	A	G	17: 6,038,115	*1480W	probably null	Het
Syt14	A	T	1: 192,930,923	M523K	probably damaging	Het
Tff3	A	T	17: 31,129,542	V12E	probably benign	Het
Tgm2	C	A	2: 158,127,342	C371F	probably damaging	Het
Tmem260	A	C	14: 48,474,044	I197L	probably benign	Het
Unc5a	A	G	13: 55,004,934	D887G	possibly damaging	Het
Vstm4	G	T	14: 32,919,290	A277S	probably benign	Het
Wdtc1	A	T	4: 133,294,391		probably null	Het
Zan	A	G	5: 137,468,338	F419S	possibly damaging	Het
Zfp317	G	A	9: 19,647,288	R266Q	probably damaging	Het
Zfp931	T	A	2: 178,067,802	T264S	possibly damaging	Het

Other mutations in Sptlc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Sptlc2	APN	12	87369068	missense	probably damaging	0.99
IGL02458:Sptlc2	APN	12	87309893	utr 3 prime	probably benign
IGL02734:Sptlc2	APN	12	87355670	missense	probably damaging	0.97
IGL03252:Sptlc2	APN	12	87355657	missense	probably benign	0.00
lopsided	UTSW	12	87341565	missense	probably benign	0.27
shinola	UTSW	12	87350295	missense	possibly damaging	0.64
R0087:Sptlc2	UTSW	12	87369118	missense	probably benign
R0116:Sptlc2	UTSW	12	87356680	missense	probably benign	0.00
R0492:Sptlc2	UTSW	12	87346806	splice site	probably null
R1353:Sptlc2	UTSW	12	87341746	missense	probably damaging	1.00
R1470:Sptlc2	UTSW	12	87355640	missense	probably benign	0.00
R1470:Sptlc2	UTSW	12	87355640	missense	probably benign	0.00
R3417:Sptlc2	UTSW	12	87346808	splice site	probably benign
R3735:Sptlc2	UTSW	12	87341565	missense	probably benign	0.27
R3736:Sptlc2	UTSW	12	87341565	missense	probably benign	0.27
R4278:Sptlc2	UTSW	12	87336151	missense	probably benign	0.04
R5252:Sptlc2	UTSW	12	87336055	missense	possibly damaging	0.49
R5656:Sptlc2	UTSW	12	87346761	missense	probably damaging	1.00
R5801:Sptlc2	UTSW	12	87341771	splice site	probably null
R6256:Sptlc2	UTSW	12	87355531	missense	probably damaging	1.00
R6280:Sptlc2	UTSW	12	87388131	missense	probably benign
R6520:Sptlc2	UTSW	12	87355662	missense	probably benign
R6808:Sptlc2	UTSW	12	87350295	missense	possibly damaging	0.64
R7133:Sptlc2	UTSW	12	87350377	missense	probably benign	0.00
R7274:Sptlc2	UTSW	12	87341606	missense	probably benign	0.24
R7366:Sptlc2	UTSW	12	87314049	critical splice donor site	probably null
R7602:Sptlc2	UTSW	12	87341689	missense	probably damaging	0.99
R9085:Sptlc2	UTSW	12	87336065	missense	probably benign	0.00
R9710:Sptlc2	UTSW	12	87312759	missense	probably benign	0.44
Z1177:Sptlc2	UTSW	12	87369044	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGGACTGTGTGACAATGACAAC -3'
(R):5'- TAAACATCAGGGTTAGATGTTGTTGGC -3'

Sequencing Primer
(F):5'- GAGCACGGTCTATTTGCAGAATC -3'
(R):5'- ATGTTGTTGGCTCTTTTTCATTGCC -3'

Posted On

2016-10-26