Incidental Mutation 'R5579:Krt4'
ID 438326
Institutional Source Beutler Lab
Gene Symbol Krt4
Ensembl Gene ENSMUSG00000059668
Gene Name keratin 4
Synonyms Krt-2.4, K4, Krt2-4
MMRRC Submission 043267-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.276) question?
Stock # R5579 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101826970-101833170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101829669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 286 (E286D)
Ref Sequence ENSEMBL: ENSMUSP00000023797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023797]
AlphaFold P07744
Predicted Effect probably benign
Transcript: ENSMUST00000023797
AA Change: E286D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023797
Gene: ENSMUSG00000059668
AA Change: E286D

DomainStartEndE-ValueType
Pfam:Keratin_2_head 14 142 4.7e-37 PFAM
Filament 145 458 1.61e-166 SMART
low complexity region 465 511 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperplasia throughout the epithelium of the esophagus and tongue. Mice homozygous or heterozygous for a dominant mutation display oral leukoplakia and homozygotes display postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G T 17: 24,595,703 (GRCm39) C352F probably damaging Het
Abce1 A T 8: 80,427,215 (GRCm39) I237N possibly damaging Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam8 T A 7: 139,568,897 (GRCm39) Y201F probably benign Het
Adgrf1 T A 17: 43,621,955 (GRCm39) C731S probably damaging Het
Akap8l A T 17: 32,540,916 (GRCm39) I529N probably damaging Het
Akap9 G A 5: 4,114,714 (GRCm39) G114D possibly damaging Het
Alox12b T A 11: 69,053,758 (GRCm39) D158E probably benign Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Ankrd42 T C 7: 92,239,390 (GRCm39) Y466C possibly damaging Het
Apobr T C 7: 126,186,847 (GRCm39) I786T probably benign Het
Arhgef12 C T 9: 42,921,489 (GRCm39) G329R probably benign Het
Btnl1 T C 17: 34,600,526 (GRCm39) probably null Het
Ccdc174 A G 6: 91,858,331 (GRCm39) probably null Het
Ccdc183 T C 2: 25,505,434 (GRCm39) D177G possibly damaging Het
Cd14 A G 18: 36,859,288 (GRCm39) Y56H probably benign Het
Cep162 G A 9: 87,085,724 (GRCm39) A1200V probably benign Het
Clic3 T C 2: 25,348,319 (GRCm39) L128P probably damaging Het
Cntnap5b A T 1: 100,311,120 (GRCm39) R538* probably null Het
Cntnap5b A T 1: 100,311,124 (GRCm39) Q539L probably benign Het
Coq7 A T 7: 118,116,558 (GRCm39) N214K unknown Het
Cramp1 G A 17: 25,192,087 (GRCm39) H1018Y possibly damaging Het
Crtac1 T A 19: 42,293,245 (GRCm39) D288V probably damaging Het
Dab2ip C T 2: 35,605,339 (GRCm39) R132* probably null Het
Dis3l C A 9: 64,238,117 (GRCm39) C125F probably benign Het
Dnmt1 A T 9: 20,831,501 (GRCm39) V543D probably damaging Het
Dock9 A T 14: 121,837,107 (GRCm39) L67Q probably damaging Het
Ehbp1 A T 11: 22,087,846 (GRCm39) S413T probably damaging Het
Endov A G 11: 119,395,923 (GRCm39) I158V probably benign Het
Epb41l4b A G 4: 57,064,802 (GRCm39) V469A possibly damaging Het
Etf1 G A 18: 35,046,654 (GRCm39) P119S probably damaging Het
Fam135a A G 1: 24,068,808 (GRCm39) L491P possibly damaging Het
Fancd2 A T 6: 113,537,012 (GRCm39) probably null Het
Fank1 T A 7: 133,471,058 (GRCm39) probably null Het
Fbh1 A G 2: 11,753,804 (GRCm39) I846T probably damaging Het
Gas2l3 T C 10: 89,249,928 (GRCm39) T397A probably benign Het
Gga1 T C 15: 78,777,388 (GRCm39) V513A probably damaging Het
Ggt1 T C 10: 75,421,782 (GRCm39) V543A probably damaging Het
Gm11596 A T 11: 99,683,717 (GRCm39) C134* probably null Het
Gnal C T 18: 67,221,842 (GRCm39) R82C unknown Het
Hat1 T C 2: 71,240,582 (GRCm39) V92A possibly damaging Het
Icosl C T 10: 77,909,597 (GRCm39) R181C probably damaging Het
Ift46 A G 9: 44,698,160 (GRCm39) M208V possibly damaging Het
Ighv1-26 T C 12: 114,752,219 (GRCm39) K42E possibly damaging Het
Ipo5 A G 14: 121,176,025 (GRCm39) K617E probably benign Het
Irx5 A G 8: 93,086,541 (GRCm39) D208G probably benign Het
Itgal T G 7: 126,906,101 (GRCm39) V397G probably benign Het
Itpr2 G A 6: 146,074,864 (GRCm39) R2297* probably null Het
Itpr3 A G 17: 27,332,493 (GRCm39) D1779G probably damaging Het
Khdc4 T C 3: 88,607,582 (GRCm39) S345P probably benign Het
Loxl4 C T 19: 42,592,729 (GRCm39) G317E probably damaging Het
Mapk6 T G 9: 75,295,344 (GRCm39) H718P possibly damaging Het
Mark2 A C 19: 7,260,181 (GRCm39) V14G probably damaging Het
Mbd5 A G 2: 49,162,826 (GRCm39) T1103A possibly damaging Het
Mcph1 A G 8: 18,682,309 (GRCm39) E482G probably benign Het
Mme G A 3: 63,256,066 (GRCm39) E509K probably damaging Het
Mrgbp A G 2: 180,227,276 (GRCm39) T204A probably damaging Het
Mycbp2 A T 14: 103,528,769 (GRCm39) F430I probably damaging Het
Myo6 A G 9: 80,125,002 (GRCm39) D27G probably damaging Het
Ncoa6 A G 2: 155,248,597 (GRCm39) L1569S probably damaging Het
Ndc1 T A 4: 107,237,901 (GRCm39) F235Y possibly damaging Het
Nmur2 A T 11: 55,923,835 (GRCm39) S240T probably benign Het
Or14c44 T A 7: 86,061,934 (GRCm39) Y121* probably null Het
Or52ae7 G A 7: 103,120,121 (GRCm39) V292M probably damaging Het
Or5d46 A T 2: 88,170,757 (GRCm39) I283F possibly damaging Het
Osbpl1a G T 18: 12,974,249 (GRCm39) A62E probably damaging Het
Osbpl1a A C 18: 13,025,319 (GRCm39) S333A probably benign Het
Otud4 C T 8: 80,390,737 (GRCm39) T417I probably benign Het
Pagr1a T C 7: 126,614,614 (GRCm39) E197G probably damaging Het
Pcdh18 T C 3: 49,699,426 (GRCm39) Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,864,690 (GRCm39) I162L probably benign Het
Pdpr T A 8: 111,850,448 (GRCm39) Y462N probably damaging Het
Pkhd1 A T 1: 20,593,366 (GRCm39) H1582Q probably damaging Het
Polr1b A G 2: 128,952,028 (GRCm39) K352R probably damaging Het
Poteg G A 8: 27,938,065 (GRCm39) V12M probably damaging Het
Pou2f1 A C 1: 165,742,731 (GRCm39) V54G probably damaging Het
Ppme1 A G 7: 99,994,182 (GRCm39) L177P probably damaging Het
Prkce A G 17: 86,927,376 (GRCm39) D550G probably damaging Het
Prrc2c A G 1: 162,508,327 (GRCm39) probably null Het
Ptpn22 A G 3: 103,789,455 (GRCm39) probably null Het
Rabif G A 1: 134,433,943 (GRCm39) V86M probably damaging Het
Rbm25 T A 12: 83,715,281 (GRCm39) M484K probably benign Het
Rcn2 G A 9: 55,964,713 (GRCm39) A224T probably benign Het
Rexo5 T A 7: 119,433,626 (GRCm39) probably null Het
Rnase1 A T 14: 51,383,219 (GRCm39) I45N probably benign Het
Rnmt T A 18: 68,439,186 (GRCm39) D98E possibly damaging Het
Rprd2 A G 3: 95,692,371 (GRCm39) F188L probably damaging Het
Scube2 G A 7: 109,409,944 (GRCm39) T643M probably damaging Het
Skic3 T C 13: 76,333,319 (GRCm39) W25R probably damaging Het
Slc7a15 T C 12: 8,589,344 (GRCm39) I68V probably benign Het
Slco1a5 A T 6: 142,187,851 (GRCm39) V496D possibly damaging Het
Slitrk6 T G 14: 110,988,649 (GRCm39) S353R possibly damaging Het
Smpd5 T A 15: 76,179,325 (GRCm39) I53K possibly damaging Het
Tas2r108 T C 6: 40,471,021 (GRCm39) S166P probably benign Het
Tcstv7a T A 13: 120,289,951 (GRCm39) M82L probably benign Het
Tecpr1 C A 5: 144,151,162 (GRCm39) V245L possibly damaging Het
Tenm3 G T 8: 48,689,799 (GRCm39) N1929K probably damaging Het
Tigd5 T G 15: 75,782,874 (GRCm39) F412C probably damaging Het
Timm17a A T 1: 135,233,926 (GRCm39) S74T possibly damaging Het
Tle1 A T 4: 72,058,045 (GRCm39) L60Q probably damaging Het
Tmem132d T C 5: 127,873,064 (GRCm39) E515G possibly damaging Het
Tmem65 T C 15: 58,666,246 (GRCm39) N115S probably benign Het
Trmt5 C A 12: 73,328,426 (GRCm39) R259L possibly damaging Het
Trmt9b T C 8: 36,979,195 (GRCm39) V266A probably benign Het
Vmn2r50 A T 7: 9,784,016 (GRCm39) W153R probably benign Het
Vwa3a T G 7: 120,367,396 (GRCm39) S184A probably benign Het
Zbtb25 A G 12: 76,395,938 (GRCm39) L428P possibly damaging Het
Zbtb49 C T 5: 38,358,160 (GRCm39) D698N probably damaging Het
Zbtb8os T G 4: 129,234,528 (GRCm39) D35E probably damaging Het
Zfp316 T C 5: 143,250,246 (GRCm39) T56A unknown Het
Zfp334 A T 2: 165,222,407 (GRCm39) C545* probably null Het
Zmiz1 C A 14: 25,645,280 (GRCm39) S247R probably damaging Het
Zscan18 A G 7: 12,509,308 (GRCm39) probably benign Het
Zzef1 T C 11: 72,791,463 (GRCm39) V2189A probably damaging Het
Other mutations in Krt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Krt4 APN 15 101,828,716 (GRCm39) missense probably damaging 1.00
IGL02306:Krt4 APN 15 101,829,740 (GRCm39) missense probably benign 0.13
IGL02407:Krt4 APN 15 101,829,740 (GRCm39) missense probably benign 0.13
IGL02504:Krt4 APN 15 101,827,727 (GRCm39) missense unknown
R0042:Krt4 UTSW 15 101,831,187 (GRCm39) splice site probably benign
R0042:Krt4 UTSW 15 101,831,187 (GRCm39) splice site probably benign
R0211:Krt4 UTSW 15 101,831,217 (GRCm39) missense possibly damaging 0.80
R0363:Krt4 UTSW 15 101,833,081 (GRCm39) missense possibly damaging 0.91
R2018:Krt4 UTSW 15 101,829,086 (GRCm39) missense probably damaging 1.00
R2067:Krt4 UTSW 15 101,833,099 (GRCm39) missense possibly damaging 0.70
R2571:Krt4 UTSW 15 101,829,692 (GRCm39) missense probably damaging 1.00
R3943:Krt4 UTSW 15 101,829,685 (GRCm39) missense probably benign 0.00
R3944:Krt4 UTSW 15 101,829,685 (GRCm39) missense probably benign 0.00
R5104:Krt4 UTSW 15 101,828,758 (GRCm39) missense probably damaging 1.00
R5107:Krt4 UTSW 15 101,831,226 (GRCm39) missense possibly damaging 0.89
R6052:Krt4 UTSW 15 101,831,194 (GRCm39) critical splice donor site probably null
R6429:Krt4 UTSW 15 101,831,229 (GRCm39) missense probably benign 0.00
R7371:Krt4 UTSW 15 101,828,823 (GRCm39) missense probably damaging 1.00
R8017:Krt4 UTSW 15 101,828,722 (GRCm39) missense probably damaging 0.99
R8019:Krt4 UTSW 15 101,828,722 (GRCm39) missense probably damaging 0.99
R8112:Krt4 UTSW 15 101,828,724 (GRCm39) missense probably damaging 1.00
R8175:Krt4 UTSW 15 101,828,984 (GRCm39) critical splice donor site probably null
R8824:Krt4 UTSW 15 101,829,077 (GRCm39) missense
R9733:Krt4 UTSW 15 101,827,564 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTTCTGAGAAACTCTCCACTG -3'
(R):5'- CGATCTTGCACAGCCTTTTAG -3'

Sequencing Primer
(F):5'- TGAGAAACTCTCCACTGACTCTC -3'
(R):5'- CACAGCCTTTTAGAATGTGTAAGGG -3'
Posted On 2016-10-26