Incidental Mutation 'R5599:Zcchc2'
ID438929
Institutional Source Beutler Lab
Gene Symbol Zcchc2
Ensembl Gene ENSMUSG00000038866
Gene Namezinc finger, CCHC domain containing 2
Synonyms9930114B20Rik
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location105990406-106034074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106032150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1163 (D1163G)
Ref Sequence ENSEMBL: ENSMUSP00000113974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118196] [ENSMUST00000119166]
Predicted Effect probably damaging
Transcript: ENSMUST00000118196
AA Change: D1163G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113974
Gene: ENSMUSG00000038866
AA Change: D1163G

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119166
SMART Domains Protein: ENSMUSP00000113128
Gene: ENSMUSG00000038866

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186983
Predicted Effect probably benign
Transcript: ENSMUST00000188954
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Zcchc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc2 APN 1 106030263 missense probably benign 0.25
IGL01339:Zcchc2 APN 1 106029775 missense probably damaging 1.00
IGL01981:Zcchc2 APN 1 106027499 missense probably damaging 1.00
IGL02172:Zcchc2 APN 1 106000934 missense probably benign 0.00
IGL02864:Zcchc2 APN 1 106016084 missense probably damaging 1.00
IGL02993:Zcchc2 APN 1 106030168 missense probably damaging 0.99
IGL03163:Zcchc2 APN 1 106031111 missense probably damaging 1.00
P0042:Zcchc2 UTSW 1 106030997 missense possibly damaging 0.95
R0200:Zcchc2 UTSW 1 106004123 missense probably damaging 1.00
R0477:Zcchc2 UTSW 1 106030270 missense possibly damaging 0.91
R0501:Zcchc2 UTSW 1 106016091 missense possibly damaging 0.88
R0689:Zcchc2 UTSW 1 106030504 nonsense probably null
R1799:Zcchc2 UTSW 1 106030287 missense probably benign 0.00
R2016:Zcchc2 UTSW 1 106004121 splice site probably null
R2153:Zcchc2 UTSW 1 106021723 splice site probably null
R2175:Zcchc2 UTSW 1 106027423 missense probably damaging 1.00
R2999:Zcchc2 UTSW 1 106030024 missense probably benign 0.00
R3113:Zcchc2 UTSW 1 105991022 missense unknown
R4571:Zcchc2 UTSW 1 106031257 missense possibly damaging 0.66
R4670:Zcchc2 UTSW 1 105990266 unclassified probably benign
R5067:Zcchc2 UTSW 1 106030964 missense probably damaging 1.00
R5423:Zcchc2 UTSW 1 106030700 missense probably damaging 1.00
R5499:Zcchc2 UTSW 1 106030592 missense possibly damaging 0.71
R5522:Zcchc2 UTSW 1 106023696 missense probably benign 0.00
R5526:Zcchc2 UTSW 1 106030254 nonsense probably null
R5571:Zcchc2 UTSW 1 106023672 missense probably benign
R6133:Zcchc2 UTSW 1 106019879 missense probably damaging 1.00
R6191:Zcchc2 UTSW 1 105990170 unclassified probably benign
R6194:Zcchc2 UTSW 1 105991117 missense probably damaging 1.00
R6246:Zcchc2 UTSW 1 106030066 missense possibly damaging 0.75
R7089:Zcchc2 UTSW 1 106030481 missense probably damaging 1.00
R7626:Zcchc2 UTSW 1 106001012 missense possibly damaging 0.69
R7749:Zcchc2 UTSW 1 106018273 missense probably damaging 1.00
R7781:Zcchc2 UTSW 1 106004165 missense probably damaging 1.00
R7792:Zcchc2 UTSW 1 106018252 missense probably damaging 0.99
R7982:Zcchc2 UTSW 1 106031171 missense probably damaging 1.00
R8316:Zcchc2 UTSW 1 106032114 missense probably damaging 1.00
R8351:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8451:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
RF022:Zcchc2 UTSW 1 106011742 missense possibly damaging 0.85
Z1176:Zcchc2 UTSW 1 105991126 missense probably damaging 1.00
Z1177:Zcchc2 UTSW 1 106004136 missense possibly damaging 0.74
Z1177:Zcchc2 UTSW 1 106029825 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAGTGCTGAGGAAAGGCC -3'
(R):5'- TGTCATACATGTAAGCCGGCTG -3'

Sequencing Primer
(F):5'- AGGCCTTTGAAAGCATGCTC -3'
(R):5'- CAGGAGCATCACATTCTTTCATATTC -3'
Posted On2016-10-26