Incidental Mutation 'R5599:Cry1'
ID438949
Institutional Source Beutler Lab
Gene Symbol Cry1
Ensembl Gene ENSMUSG00000020038
Gene Namecryptochrome 1 (photolyase-like)
SynonymsPhll1
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85131700-85185064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85144250 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 398 (M398K)
Ref Sequence ENSEMBL: ENSMUSP00000020227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020227]
PDB Structure Crystal Structure of Mouse Cryptochrome1 in Complex with Period2 [X-RAY DIFFRACTION]
Crystal structure of mouse Cryptochrome 1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020227
AA Change: M398K

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020227
Gene: ENSMUSG00000020038
AA Change: M398K

DomainStartEndE-ValueType
Pfam:DNA_photolyase 5 168 1.4e-47 PFAM
Pfam:FAD_binding_7 213 486 6.9e-91 PFAM
internal_repeat_1 502 523 3.57e-8 PROSPERO
internal_repeat_1 521 543 3.57e-8 PROSPERO
low complexity region 544 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214248
Predicted Effect probably benign
Transcript: ENSMUST00000214675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214805
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of this gene results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour shorter circadian period under constant darkness and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Cry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Cry1 APN 10 85146834 missense probably benign 0.11
IGL00737:Cry1 APN 10 85143040 missense probably benign 0.02
IGL01349:Cry1 APN 10 85148739 missense probably benign 0.00
IGL01544:Cry1 APN 10 85146496 nonsense probably null
IGL01545:Cry1 APN 10 85184362 missense possibly damaging 0.94
IGL01767:Cry1 APN 10 85146474 missense probably damaging 1.00
IGL03392:Cry1 APN 10 85157129 missense possibly damaging 0.88
R0119:Cry1 UTSW 10 85133240 critical splice donor site probably null
R0605:Cry1 UTSW 10 85184359 missense probably damaging 0.96
R1618:Cry1 UTSW 10 85146454 missense probably damaging 1.00
R1955:Cry1 UTSW 10 85144178 missense probably benign 0.00
R2209:Cry1 UTSW 10 85146755 missense probably damaging 0.98
R2221:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2223:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2314:Cry1 UTSW 10 85133311 missense probably benign 0.08
R3851:Cry1 UTSW 10 85146499 missense probably benign 0.15
R3872:Cry1 UTSW 10 85133160 critical splice acceptor site probably null
R3981:Cry1 UTSW 10 85146592 missense probably damaging 0.99
R4856:Cry1 UTSW 10 85148770 missense probably damaging 0.97
R5162:Cry1 UTSW 10 85133286 missense probably benign
R5404:Cry1 UTSW 10 85184419 missense probably damaging 1.00
R5449:Cry1 UTSW 10 85133135 missense probably benign 0.17
R5484:Cry1 UTSW 10 85146724 splice site probably null
R5717:Cry1 UTSW 10 85146416 missense probably damaging 1.00
R7031:Cry1 UTSW 10 85148662 missense probably benign 0.00
R7371:Cry1 UTSW 10 85147919 missense probably benign 0.03
R7943:Cry1 UTSW 10 85143120 missense probably benign 0.03
R8022:Cry1 UTSW 10 85146402 missense probably damaging 0.97
R8290:Cry1 UTSW 10 85143113 nonsense probably null
R8805:Cry1 UTSW 10 85157105 missense probably benign 0.09
Z1176:Cry1 UTSW 10 85144197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGTGTTGCTAAGCACAAAGAGC -3'
(R):5'- TCCAGAAAGCTGTATTTCCTGTG -3'

Sequencing Primer
(F):5'- GTTGCTAAGCACAAAGAGCTAGCTC -3'
(R):5'- CAGAAAGCTGTATTTCCTGTGTATTC -3'
Posted On2016-10-26