Incidental Mutation 'R5604:Cd8b1'
ID439178
Institutional Source Beutler Lab
Gene Symbol Cd8b1
Ensembl Gene ENSMUSG00000053044
Gene NameCD8 antigen, beta chain 1
SynonymsLy-3, Ly-C, Lyt-3
MMRRC Submission 043156-MU
Accession Numbers

Genbank: NM_009858; MGI: 88347

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71322788-71337494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71326175 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000070131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065248] [ENSMUST00000114188] [ENSMUST00000173297]
PDB Structure
Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION]
Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION]
Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000065248
AA Change: V78A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070131
Gene: ENSMUSG00000053044
AA Change: V78A

DomainStartEndE-ValueType
IGv 36 119 2.33e-13 SMART
low complexity region 141 156 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114188
SMART Domains Protein: ENSMUSP00000109826
Gene: ENSMUSG00000055027

DomainStartEndE-ValueType
Pfam:zf-MYND 18 56 5.4e-11 PFAM
SET 76 225 1.53e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173297
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. [provided by RefSeq, May 2010]
PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Qrich1 A G 9: 108,559,303 probably null Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Cd8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cd8b1 APN 6 71332479 nonsense probably null
Carlsbad UTSW 6 71334101 missense probably damaging 1.00
denuded UTSW 6 71326340 missense probably damaging 1.00
3-1:Cd8b1 UTSW 6 71326262 missense probably damaging 1.00
R1707:Cd8b1 UTSW 6 71326184 missense probably damaging 1.00
R2438:Cd8b1 UTSW 6 71329756 missense probably damaging 0.96
R2860:Cd8b1 UTSW 6 71334101 missense probably damaging 1.00
R2861:Cd8b1 UTSW 6 71334101 missense probably damaging 1.00
R4405:Cd8b1 UTSW 6 71326022 missense possibly damaging 0.90
R4583:Cd8b1 UTSW 6 71326097 missense probably damaging 1.00
R4611:Cd8b1 UTSW 6 71332475 missense probably benign
R4657:Cd8b1 UTSW 6 71329774 missense possibly damaging 0.77
R6795:Cd8b1 UTSW 6 71326340 missense probably damaging 1.00
R6828:Cd8b1 UTSW 6 71334116 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGCTCTGCCCTCATTCAGAC -3'
(R):5'- TAGTCATGGCTGCAGAGTGAGG -3'

Sequencing Primer
(F):5'- AGACCCCTTCGTCCCTG -3'
(R):5'- GTGCTCATTCACAGCCTTGAGAAC -3'
Posted On2016-10-26