Incidental Mutation 'R5628:Stard5'
ID441927
Institutional Source Beutler Lab
Gene Symbol Stard5
Ensembl Gene ENSMUSG00000046027
Gene NameStAR-related lipid transfer (START) domain containing 5
Synonyms2310058G22Rik, D7Ertd152e, 18B7-T7(GS)
MMRRC Submission 043167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5628 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location83631959-83653127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83633147 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 56 (I56T)
Ref Sequence ENSEMBL: ENSMUSP00000112781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075418] [ENSMUST00000117410]
Predicted Effect probably benign
Transcript: ENSMUST00000075418
AA Change: I56T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027
AA Change: I56T

DomainStartEndE-ValueType
START 7 210 8.57e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117410
AA Change: I56T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027
AA Change: I56T

DomainStartEndE-ValueType
Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208892
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vertebral transverse process morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,710 D671G probably benign Het
Ap3b1 A G 13: 94,477,048 D685G unknown Het
Atp6v1h G A 1: 5,135,889 W358* probably null Het
Atr T A 9: 95,874,226 Y830* probably null Het
B3galnt2 A T 13: 13,995,152 probably null Het
Casz1 T C 4: 148,946,096 Y1191H probably damaging Het
Cdc40 T G 10: 40,851,053 E169D probably benign Het
Cep55 C T 19: 38,069,948 Q330* probably null Het
Clcn1 T C 6: 42,298,889 V315A probably damaging Het
Cmya5 A G 13: 93,089,710 F2957L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dync1li2 T C 8: 104,420,592 N490S possibly damaging Het
Ephb3 T C 16: 21,218,119 Y111H probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fat3 T C 9: 15,966,096 Y3407C probably damaging Het
Fbxw8 A G 5: 118,092,557 V393A probably damaging Het
Fnip1 A T 11: 54,503,633 D965V probably benign Het
Gramd2 T C 9: 59,707,723 M3T probably benign Het
Kctd15 T C 7: 34,640,295 D283G probably damaging Het
Kif9 C T 9: 110,514,553 R547* probably null Het
Map4 A G 9: 110,081,847 T245A probably benign Het
Mindy4 C T 6: 55,260,594 L385F probably damaging Het
Myo7b A G 18: 31,974,187 C1252R probably benign Het
Myt1l T A 12: 29,811,621 I134N unknown Het
Olfr1022 T A 2: 85,868,805 I71N probably damaging Het
Osgin2 T A 4: 15,998,998 N208I probably benign Het
Polr2b G A 5: 77,313,216 V29M probably damaging Het
Prdm15 T A 16: 97,799,623 M812L probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rev3l T A 10: 39,822,967 N1153K probably damaging Het
Rnf17 A G 14: 56,486,952 probably null Het
Rusc2 C T 4: 43,425,348 T1151M probably damaging Het
Scrib T C 15: 76,049,540 T30A possibly damaging Het
Sephs1 T C 2: 4,889,207 I73T probably benign Het
Sf3b1 C T 1: 54,998,175 A861T probably benign Het
Shq1 A G 6: 100,631,003 W316R probably damaging Het
Slc26a5 T A 5: 21,816,976 D484V probably benign Het
Smg1 C T 7: 118,154,701 probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tmem217 A T 17: 29,526,456 I100N probably damaging Het
Trpm2 C T 10: 77,912,636 R1400Q probably benign Het
Vmn1r82 T G 7: 12,305,278 N41K probably damaging Het
Zfp236 T C 18: 82,657,122 D367G probably damaging Het
Zfyve1 A T 12: 83,574,889 V244E probably benign Het
Other mutations in Stard5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Stard5 APN 7 83633189 missense probably damaging 1.00
IGL02100:Stard5 APN 7 83640445 missense possibly damaging 0.71
IGL03374:Stard5 APN 7 83636772 missense possibly damaging 0.83
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0631:Stard5 UTSW 7 83632757 missense probably damaging 1.00
R2170:Stard5 UTSW 7 83633158 missense probably benign 0.01
R2995:Stard5 UTSW 7 83632743 missense probably damaging 1.00
R4616:Stard5 UTSW 7 83633281 intron probably benign
R5372:Stard5 UTSW 7 83633220 missense probably damaging 1.00
R7836:Stard5 UTSW 7 83636776 missense probably damaging 1.00
R7919:Stard5 UTSW 7 83636776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTGTGTTCTGTGAGGAC -3'
(R):5'- TTGTTTCCTGCCAGGGACAAG -3'

Sequencing Primer
(F):5'- ACCTGTTTGTTTATGCAGGCTAGAG -3'
(R):5'- AAGGCTGGACTCGTCTGCATG -3'
Posted On2016-11-08