Incidental Mutation 'R4616:Stard5'
ID 351044
Institutional Source Beutler Lab
Gene Symbol Stard5
Ensembl Gene ENSMUSG00000046027
Gene Name StAR-related lipid transfer (START) domain containing 5
Synonyms 2310058G22Rik, D7Ertd152e, 18B7-T7(GS)
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 83631959-83653127 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to T at 83633281 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075418] [ENSMUST00000117410]
AlphaFold Q9EPQ7
Predicted Effect probably benign
Transcript: ENSMUST00000075418
SMART Domains Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027

DomainStartEndE-ValueType
START 7 210 8.57e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117410
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

DomainStartEndE-ValueType
Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208892
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vertebral transverse process morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Stard5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Stard5 APN 7 83633189 missense probably damaging 1.00
IGL02100:Stard5 APN 7 83640445 missense possibly damaging 0.71
IGL03374:Stard5 APN 7 83636772 missense possibly damaging 0.83
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0631:Stard5 UTSW 7 83632757 missense probably damaging 1.00
R2170:Stard5 UTSW 7 83633158 missense probably benign 0.01
R2995:Stard5 UTSW 7 83632743 missense probably damaging 1.00
R5372:Stard5 UTSW 7 83633220 missense probably damaging 1.00
R5628:Stard5 UTSW 7 83633147 missense probably benign 0.30
R7836:Stard5 UTSW 7 83636776 missense probably damaging 1.00
R9249:Stard5 UTSW 7 83632045 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGATCAAATTCCTCTCCATTCTAG -3'
(R):5'- TGGTGTAAATCCAGGCCTGC -3'

Sequencing Primer
(F):5'- TCTCCATTCTAGGTACCGAGGAG -3'
(R):5'- GCAATTCCTCAGCTATAGTCTGTAG -3'
Posted On 2015-10-08