Incidental Mutation 'R1608:F13a1'
ID176643
Institutional Source Beutler Lab
Gene Symbol F13a1
Ensembl Gene ENSMUSG00000039109
Gene Namecoagulation factor XIII, A1 subunit
SynonymsFactor XIIIA, 1200014I03Rik
MMRRC Submission 039645-MU
Accession Numbers

Genbank: NM_028784; MGI: 1921395

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location36867178-37050244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36868811 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 718 (V718A)
Ref Sequence ENSEMBL: ENSMUSP00000128316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037491] [ENSMUST00000164727]
Predicted Effect probably damaging
Transcript: ENSMUST00000037491
AA Change: V718A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048667
Gene: ENSMUSG00000039109
AA Change: V718A

DomainStartEndE-ValueType
Pfam:Transglut_N 47 165 9e-34 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2e-26 PFAM
Pfam:Transglut_C 631 728 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164727
AA Change: V718A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128316
Gene: ENSMUSG00000039109
AA Change: V718A

DomainStartEndE-ValueType
Pfam:Transglut_N 46 167 3e-38 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2.2e-23 PFAM
Pfam:Transglut_C 631 728 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225846
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit A of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit B to form a heterotetrameric proenzyme that undergoes thrombin-mediated proteolysis to generate active factor XIIIa. The transglutaminase activity of factor XIIIa is required for the calcium-dependent crosslinking of fibrin, leading to the formation of a clot. Mice lacking the encoded protein display impaired reproduction and reduced survival due to bleeding episodes, hematothorax, hematoperitoneum and subcutaneous hemorrhage. Additionally, mice lacking the encoded protein exhibit impaired wound healing and inadequate healing of myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice exhibit bleeding symptoms, increased lethality, and impaired fertility. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in F13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:F13a1 APN 13 36988878 missense probably benign 0.11
IGL01444:F13a1 APN 13 36918577 missense probably null 1.00
IGL02188:F13a1 APN 13 36906061 splice site probably benign
IGL02591:F13a1 APN 13 36898057 missense probably damaging 1.00
IGL02660:F13a1 APN 13 36943894 missense possibly damaging 0.92
IGL03244:F13a1 APN 13 36988896 missense possibly damaging 0.82
IGL03401:F13a1 APN 13 36898080 missense probably benign 0.00
F6893:F13a1 UTSW 13 36972025 missense probably damaging 1.00
R0082:F13a1 UTSW 13 36988953 missense probably damaging 0.99
R0657:F13a1 UTSW 13 36968105 missense probably damaging 0.96
R1225:F13a1 UTSW 13 37025851 missense probably benign
R1430:F13a1 UTSW 13 36898131 missense probably damaging 1.00
R1883:F13a1 UTSW 13 36989007 missense probably benign 0.01
R2115:F13a1 UTSW 13 36988857 missense probably damaging 1.00
R2121:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2122:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2125:F13a1 UTSW 13 36892841 missense probably benign 0.15
R2392:F13a1 UTSW 13 36943997 missense possibly damaging 0.65
R3618:F13a1 UTSW 13 36943993 missense probably damaging 1.00
R3625:F13a1 UTSW 13 36898093 missense probably benign 0.31
R3772:F13a1 UTSW 13 36898134 missense probably benign
R3838:F13a1 UTSW 13 37047424 missense probably damaging 1.00
R3857:F13a1 UTSW 13 37025694 missense probably benign 0.32
R3937:F13a1 UTSW 13 36916901 missense probably damaging 1.00
R4934:F13a1 UTSW 13 36877762 missense probably benign 0.00
R4974:F13a1 UTSW 13 36916863 critical splice donor site probably null
R5033:F13a1 UTSW 13 36988856 missense probably damaging 1.00
R5194:F13a1 UTSW 13 36972063 missense probably damaging 1.00
R5740:F13a1 UTSW 13 36898204 missense probably benign 0.02
R5753:F13a1 UTSW 13 36898108 nonsense probably null
R6188:F13a1 UTSW 13 37025778 missense probably benign 0.12
R7048:F13a1 UTSW 13 36898143 missense probably benign 0.02
R7197:F13a1 UTSW 13 36916886 missense probably damaging 1.00
R7816:F13a1 UTSW 13 37025771 missense probably benign 0.00
R7843:F13a1 UTSW 13 37025771 missense probably benign 0.00
R7902:F13a1 UTSW 13 36988939 missense probably damaging 1.00
R8124:F13a1 UTSW 13 37025805 missense probably damaging 1.00
R8443:F13a1 UTSW 13 37025718 missense probably damaging 1.00
Z1088:F13a1 UTSW 13 36989012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGAATCGGTCTCAGTCTTCACAC -3'
(R):5'- CAGGGATGCTCAGCTATGCTCTTAC -3'

Sequencing Primer
(F):5'- TCTCAGTCTTCACACCCAAATTAAAG -3'
(R):5'- TTGCTGAATCAGCCAACTAGG -3'
Posted On2014-04-24