Incidental Mutation 'R0082:F13a1'
ID19734
Institutional Source Beutler Lab
Gene Symbol F13a1
Ensembl Gene ENSMUSG00000039109
Gene Namecoagulation factor XIII, A1 subunit
SynonymsFactor XIIIA, 1200014I03Rik
MMRRC Submission 038369-MU
Accession Numbers

Genbank: NM_028784; MGI: 1921395

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0082 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location36867178-37050244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36988953 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 151 (P151Q)
Ref Sequence ENSEMBL: ENSMUSP00000128316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037491] [ENSMUST00000164727]
Predicted Effect probably damaging
Transcript: ENSMUST00000037491
AA Change: P151Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048667
Gene: ENSMUSG00000039109
AA Change: P151Q

DomainStartEndE-ValueType
Pfam:Transglut_N 47 165 9e-34 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2e-26 PFAM
Pfam:Transglut_C 631 728 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164727
AA Change: P151Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128316
Gene: ENSMUSG00000039109
AA Change: P151Q

DomainStartEndE-ValueType
Pfam:Transglut_N 46 167 3e-38 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2.2e-23 PFAM
Pfam:Transglut_C 631 728 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225168
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: This gene encodes subunit A of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit B to form a heterotetrameric proenzyme that undergoes thrombin-mediated proteolysis to generate active factor XIIIa. The transglutaminase activity of factor XIIIa is required for the calcium-dependent crosslinking of fibrin, leading to the formation of a clot. Mice lacking the encoded protein display impaired reproduction and reduced survival due to bleeding episodes, hematothorax, hematoperitoneum and subcutaneous hemorrhage. Additionally, mice lacking the encoded protein exhibit impaired wound healing and inadequate healing of myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice exhibit bleeding symptoms, increased lethality, and impaired fertility. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in F13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:F13a1 APN 13 36988878 missense probably benign 0.11
IGL01444:F13a1 APN 13 36918577 missense probably null 1.00
IGL02188:F13a1 APN 13 36906061 splice site probably benign
IGL02591:F13a1 APN 13 36898057 missense probably damaging 1.00
IGL02660:F13a1 APN 13 36943894 missense possibly damaging 0.92
IGL03244:F13a1 APN 13 36988896 missense possibly damaging 0.82
IGL03401:F13a1 APN 13 36898080 missense probably benign 0.00
F6893:F13a1 UTSW 13 36972025 missense probably damaging 1.00
R0657:F13a1 UTSW 13 36968105 missense probably damaging 0.96
R1225:F13a1 UTSW 13 37025851 missense probably benign
R1430:F13a1 UTSW 13 36898131 missense probably damaging 1.00
R1608:F13a1 UTSW 13 36868811 missense probably damaging 1.00
R1883:F13a1 UTSW 13 36989007 missense probably benign 0.01
R2115:F13a1 UTSW 13 36988857 missense probably damaging 1.00
R2121:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2122:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2125:F13a1 UTSW 13 36892841 missense probably benign 0.15
R2392:F13a1 UTSW 13 36943997 missense possibly damaging 0.65
R3618:F13a1 UTSW 13 36943993 missense probably damaging 1.00
R3625:F13a1 UTSW 13 36898093 missense probably benign 0.31
R3772:F13a1 UTSW 13 36898134 missense probably benign
R3838:F13a1 UTSW 13 37047424 missense probably damaging 1.00
R3857:F13a1 UTSW 13 37025694 missense probably benign 0.32
R3937:F13a1 UTSW 13 36916901 missense probably damaging 1.00
R4934:F13a1 UTSW 13 36877762 missense probably benign 0.00
R4974:F13a1 UTSW 13 36916863 critical splice donor site probably null
R5033:F13a1 UTSW 13 36988856 missense probably damaging 1.00
R5194:F13a1 UTSW 13 36972063 missense probably damaging 1.00
R5740:F13a1 UTSW 13 36898204 missense probably benign 0.02
R5753:F13a1 UTSW 13 36898108 nonsense probably null
R6188:F13a1 UTSW 13 37025778 missense probably benign 0.12
R7048:F13a1 UTSW 13 36898143 missense probably benign 0.02
R7197:F13a1 UTSW 13 36916886 missense probably damaging 1.00
R7816:F13a1 UTSW 13 37025771 missense probably benign 0.00
Z1088:F13a1 UTSW 13 36989012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTACAATTTGGAATCGTGGGAACTTC -3'
(R):5'- CAGCTACTATCACATCCCTTGGCAG -3'

Sequencing Primer
(F):5'- GCTCCTTACCTTCACACCAA -3'
(R):5'- CTGCCACAGGATTAGATTTGGAAC -3'
Posted On2013-04-11