Incidental Mutation 'R5744:Eif3f'
ID445715
Institutional Source Beutler Lab
Gene Symbol Eif3f
Ensembl Gene ENSMUSG00000031029
Gene Nameeukaryotic translation initiation factor 3, subunit F
SynonymsEif3s5, 0610037M02Rik
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108934417-108942951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108938417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 179 (T179K)
Ref Sequence ENSEMBL: ENSMUSP00000033342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033342]
Predicted Effect probably damaging
Transcript: ENSMUST00000033342
AA Change: T179K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033342
Gene: ENSMUSG00000031029
AA Change: T179K

DomainStartEndE-ValueType
low complexity region 2 93 N/A INTRINSIC
JAB_MPN 95 225 3.11e-42 SMART
Pfam:MitMem_reg 247 359 7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153596
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Dip2c A T 13: 9,568,405 I497F probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Hs6st3 T C 14: 119,138,440 L9P possibly damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Il1rap A C 16: 26,680,224 I158L probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nol8 A G 13: 49,662,326 N619D possibly damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Olfr825 T C 10: 130,162,792 D178G possibly damaging Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc2a8 C T 2: 32,976,028 D291N probably benign Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Eif3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Eif3f APN 7 108934718 missense probably damaging 1.00
IGL02821:Eif3f APN 7 108934674 unclassified probably benign
IGL02821:Eif3f APN 7 108934675 unclassified probably benign
R0010:Eif3f UTSW 7 108941005 missense possibly damaging 0.93
R1054:Eif3f UTSW 7 108937817 critical splice donor site probably null
R1886:Eif3f UTSW 7 108940751 missense probably benign 0.08
R2877:Eif3f UTSW 7 108934812 splice site probably null
R3700:Eif3f UTSW 7 108940275 missense probably benign 0.23
R3882:Eif3f UTSW 7 108940955 missense possibly damaging 0.88
R4471:Eif3f UTSW 7 108940946 missense possibly damaging 0.79
R4472:Eif3f UTSW 7 108940946 missense possibly damaging 0.79
R4817:Eif3f UTSW 7 108937775 missense probably damaging 0.99
R4953:Eif3f UTSW 7 108934640 unclassified probably benign
R7162:Eif3f UTSW 7 108940731 missense probably benign 0.02
R7235:Eif3f UTSW 7 108938088 missense possibly damaging 0.78
R7445:Eif3f UTSW 7 108934658 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGCATGTGACCTCGAGAGC -3'
(R):5'- TTCCTGAAGAGAAACTAAGCGG -3'

Sequencing Primer
(F):5'- ATGTGACCTCGAGAGCCTATG -3'
(R):5'- CTAAGCGGCAGGATTAGACC -3'
Posted On2016-11-21