Incidental Mutation 'R5799:Slc38a2'
ID447421
Institutional Source Beutler Lab
Gene Symbol Slc38a2
Ensembl Gene ENSMUSG00000022462
Gene Namesolute carrier family 38, member 2
Synonyms5033402L14Rik
MMRRC Submission 043388-MU
Accession Numbers

NCBI RefSeq: NM_175121.3; MGI:1915010

Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96687392-96699730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96695089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 163 (S163T)
Ref Sequence ENSEMBL: ENSMUSP00000023099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023099]
Predicted Effect probably benign
Transcript: ENSMUST00000023099
AA Change: S163T

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023099
Gene: ENSMUSG00000022462
AA Change: S163T

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
Pfam:Aa_trans 69 492 2e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229141
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
Allele List at MGI

All alleles(18) : Targeted(2) Gene trapped(16)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Slc38a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Slc38a2 APN 15 96693185 splice site probably benign
IGL01522:Slc38a2 APN 15 96693055 missense possibly damaging 0.78
IGL01679:Slc38a2 APN 15 96697954 nonsense probably null
IGL01720:Slc38a2 APN 15 96691211 splice site probably benign
IGL02198:Slc38a2 APN 15 96692377 missense probably damaging 0.99
IGL02685:Slc38a2 APN 15 96691425 missense probably benign 0.00
IGL03211:Slc38a2 APN 15 96698272 splice site probably null
P0014:Slc38a2 UTSW 15 96690161 missense probably damaging 0.96
R0068:Slc38a2 UTSW 15 96691292 splice site probably null
R0068:Slc38a2 UTSW 15 96691292 splice site probably null
R0684:Slc38a2 UTSW 15 96695287 nonsense probably null
R1537:Slc38a2 UTSW 15 96693153 missense possibly damaging 0.50
R1638:Slc38a2 UTSW 15 96692536 missense probably damaging 1.00
R1922:Slc38a2 UTSW 15 96691162 missense possibly damaging 0.95
R2294:Slc38a2 UTSW 15 96691762 missense probably benign
R4672:Slc38a2 UTSW 15 96698637 missense probably benign 0.00
R5878:Slc38a2 UTSW 15 96692584 missense probably damaging 0.96
R6188:Slc38a2 UTSW 15 96692516 critical splice donor site probably null
R7097:Slc38a2 UTSW 15 96693301 missense probably damaging 0.98
R7122:Slc38a2 UTSW 15 96693301 missense probably damaging 0.98
R7130:Slc38a2 UTSW 15 96691382 missense probably damaging 1.00
R7224:Slc38a2 UTSW 15 96691359 missense probably damaging 1.00
R7776:Slc38a2 UTSW 15 96690152 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTGTCATAAGTATTCTCCACGGGG -3'
(R):5'- TGGGACATAAGGCGTATGGTC -3'

Sequencing Primer
(F):5'- AAGTATTCTCCACGGGGATACTC -3'
(R):5'- GTCTGGCTGGAAAGCTAGC -3'
Posted On2016-12-15