Incidental Mutation 'R5727:Ppfia4'
ID452538
Institutional Source Beutler Lab
Gene Symbol Ppfia4
Ensembl Gene ENSMUSG00000026458
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134296783-134332928 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 134324077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168515] [ENSMUST00000168515] [ENSMUST00000168515] [ENSMUST00000186730] [ENSMUST00000186730] [ENSMUST00000186730] [ENSMUST00000189361] [ENSMUST00000189361] [ENSMUST00000189361]
Predicted Effect probably null
Transcript: ENSMUST00000168515
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168515
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168515
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186730
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186730
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186730
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189361
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189361
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189361
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Ppfia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Ppfia4 APN 1 134328086 missense probably benign 0.00
IGL01935:Ppfia4 APN 1 134317936 missense probably benign 0.02
IGL02008:Ppfia4 APN 1 134332391 missense probably damaging 1.00
R0037:Ppfia4 UTSW 1 134324089 missense probably damaging 1.00
R0084:Ppfia4 UTSW 1 134299426 missense possibly damaging 0.84
R0108:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0254:Ppfia4 UTSW 1 134324224 splice site probably benign
R0445:Ppfia4 UTSW 1 134327289 missense probably benign 0.31
R0504:Ppfia4 UTSW 1 134324113 missense probably damaging 1.00
R0617:Ppfia4 UTSW 1 134328780 missense probably damaging 1.00
R0839:Ppfia4 UTSW 1 134328807 missense probably null 1.00
R0849:Ppfia4 UTSW 1 134319372 missense probably benign 0.45
R0898:Ppfia4 UTSW 1 134321126 missense probably benign
R1173:Ppfia4 UTSW 1 134332283 splice site probably benign
R1728:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1729:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1730:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1762:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1783:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1784:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1785:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1812:Ppfia4 UTSW 1 134324573 missense probably benign 0.04
R2148:Ppfia4 UTSW 1 134312634 missense probably benign 0.25
R2160:Ppfia4 UTSW 1 134313723 missense probably benign 0.40
R2308:Ppfia4 UTSW 1 134332397 missense possibly damaging 0.94
R2421:Ppfia4 UTSW 1 134327400 missense probably benign 0.00
R3694:Ppfia4 UTSW 1 134312567 missense probably damaging 1.00
R3707:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3708:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3725:Ppfia4 UTSW 1 134313711 missense probably benign 0.04
R3964:Ppfia4 UTSW 1 134323016 missense probably benign
R4889:Ppfia4 UTSW 1 134300514 missense probably damaging 1.00
R4909:Ppfia4 UTSW 1 134332501 missense probably damaging 0.97
R4939:Ppfia4 UTSW 1 134328079 missense possibly damaging 0.67
R5226:Ppfia4 UTSW 1 134304286 critical splice donor site probably null
R5433:Ppfia4 UTSW 1 134317894 missense probably damaging 1.00
R5576:Ppfia4 UTSW 1 134323050 missense possibly damaging 0.81
R5793:Ppfia4 UTSW 1 134312106 missense probably damaging 1.00
R6193:Ppfia4 UTSW 1 134324161 missense probably benign 0.04
R6216:Ppfia4 UTSW 1 134329183 missense probably damaging 1.00
R6679:Ppfia4 UTSW 1 134309679 missense probably damaging 1.00
R6742:Ppfia4 UTSW 1 134329171 missense probably damaging 1.00
R7039:Ppfia4 UTSW 1 134312115 missense probably damaging 0.97
R7206:Ppfia4 UTSW 1 134327389 missense probably benign 0.00
R7259:Ppfia4 UTSW 1 134313100 missense probably damaging 1.00
R7454:Ppfia4 UTSW 1 134324135 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCTTGGAGTGACCCCGATC -3'
(R):5'- ACAAGCCTTGTGGAGACTAAG -3'

Sequencing Primer
(F):5'- TGACCCCGATCTCAGGTGTC -3'
(R):5'- CCTTGTGGAGACTAAGTACAAGATG -3'
Posted On2017-01-03