Incidental Mutation 'R0849:Ppfia4'
ID77043
Institutional Source Beutler Lab
Gene Symbol Ppfia4
Ensembl Gene ENSMUSG00000026458
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134296783-134332928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134319372 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 537 (F537I)
Ref Sequence ENSEMBL: ENSMUSP00000128314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168515] [ENSMUST00000186730] [ENSMUST00000189361]
Predicted Effect probably benign
Transcript: ENSMUST00000168515
AA Change: F537I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458
AA Change: F537I

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186730
AA Change: F254I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458
AA Change: F254I

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189361
AA Change: F537I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458
AA Change: F537I

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Ppfia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Ppfia4 APN 1 134328086 missense probably benign 0.00
IGL01935:Ppfia4 APN 1 134317936 missense probably benign 0.02
IGL02008:Ppfia4 APN 1 134332391 missense probably damaging 1.00
R0037:Ppfia4 UTSW 1 134324089 missense probably damaging 1.00
R0084:Ppfia4 UTSW 1 134299426 missense possibly damaging 0.84
R0108:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0254:Ppfia4 UTSW 1 134324224 splice site probably benign
R0445:Ppfia4 UTSW 1 134327289 missense probably benign 0.31
R0504:Ppfia4 UTSW 1 134324113 missense probably damaging 1.00
R0617:Ppfia4 UTSW 1 134328780 missense probably damaging 1.00
R0839:Ppfia4 UTSW 1 134328807 missense probably null 1.00
R0898:Ppfia4 UTSW 1 134321126 missense probably benign
R1173:Ppfia4 UTSW 1 134332283 splice site probably benign
R1728:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1729:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1730:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1762:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1783:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1784:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1785:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1812:Ppfia4 UTSW 1 134324573 missense probably benign 0.04
R2148:Ppfia4 UTSW 1 134312634 missense probably benign 0.25
R2160:Ppfia4 UTSW 1 134313723 missense probably benign 0.40
R2308:Ppfia4 UTSW 1 134332397 missense possibly damaging 0.94
R2421:Ppfia4 UTSW 1 134327400 missense probably benign 0.00
R3694:Ppfia4 UTSW 1 134312567 missense probably damaging 1.00
R3707:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3708:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3725:Ppfia4 UTSW 1 134313711 missense probably benign 0.04
R3964:Ppfia4 UTSW 1 134323016 missense probably benign
R4889:Ppfia4 UTSW 1 134300514 missense probably damaging 1.00
R4909:Ppfia4 UTSW 1 134332501 missense probably damaging 0.97
R4939:Ppfia4 UTSW 1 134328079 missense possibly damaging 0.67
R5226:Ppfia4 UTSW 1 134304286 critical splice donor site probably null
R5433:Ppfia4 UTSW 1 134317894 missense probably damaging 1.00
R5576:Ppfia4 UTSW 1 134323050 missense possibly damaging 0.81
R5727:Ppfia4 UTSW 1 134324077 critical splice donor site probably null
R5793:Ppfia4 UTSW 1 134312106 missense probably damaging 1.00
R6193:Ppfia4 UTSW 1 134324161 missense probably benign 0.04
R6216:Ppfia4 UTSW 1 134329183 missense probably damaging 1.00
R6679:Ppfia4 UTSW 1 134309679 missense probably damaging 1.00
R6742:Ppfia4 UTSW 1 134329171 missense probably damaging 1.00
R7039:Ppfia4 UTSW 1 134312115 missense probably damaging 0.97
R7206:Ppfia4 UTSW 1 134327389 missense probably benign 0.00
R7259:Ppfia4 UTSW 1 134313100 missense probably damaging 1.00
R7454:Ppfia4 UTSW 1 134324135 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CACGGGCATACTGAATACCAGGAAC -3'
(R):5'- ACACTGGAGCCTTGGGTCAAAGAG -3'

Sequencing Primer
(F):5'- TGACACCTAGAGTCATCTGTAGC -3'
(R):5'- TCAAAGAGGCTGTGCCAG -3'
Posted On2013-10-16