Incidental Mutation 'IGL03098:Efnb2'
ID 452976
Institutional Source Beutler Lab
Gene Symbol Efnb2
Ensembl Gene ENSMUSG00000001300
Gene Name ephrin B2
Synonyms Eplg5, Epl5, Lerk5, Htk-L, NLERK-1, LERK-5, ELF-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # IGL03098 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 8667434-8711242 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 8713420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001319] [ENSMUST00000048545] [ENSMUST00000207817]
AlphaFold P52800
Predicted Effect probably benign
Transcript: ENSMUST00000001319
SMART Domains Protein: ENSMUSP00000001319
Gene: ENSMUSG00000001300

DomainStartEndE-ValueType
Pfam:Ephrin 32 167 4.6e-53 PFAM
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048545
SMART Domains Protein: ENSMUSP00000039493
Gene: ENSMUSG00000040459

DomainStartEndE-ValueType
low complexity region 3 75 N/A INTRINSIC
low complexity region 95 113 N/A INTRINSIC
Pfam:ARGLU 117 267 8.2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207070
Predicted Effect probably benign
Transcript: ENSMUST00000207817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209169
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in angiogenesis of both arteries and veins and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Abca15 T C 7: 119,987,499 (GRCm39) probably null Het
Adcy4 T C 14: 56,019,038 (GRCm39) Q173R probably null Het
Arhgef19 A G 4: 140,974,879 (GRCm39) D113G possibly damaging Het
Btbd6 A G 12: 112,942,038 (GRCm39) E501G probably damaging Het
Btnl2 T C 17: 34,584,190 (GRCm39) V371A probably benign Het
Cd84 G T 1: 171,700,267 (GRCm39) R128L possibly damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dsg3 A T 18: 20,643,422 (GRCm39) probably benign Het
Fam24b T C 7: 130,927,977 (GRCm39) S71G probably benign Het
Flacc1 G T 1: 58,730,908 (GRCm39) H49Q probably benign Het
Hgd G A 16: 37,436,607 (GRCm39) C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,194,002 (GRCm39) probably benign Het
Hsd17b7 C T 1: 169,780,649 (GRCm39) E320K probably damaging Het
Kcmf1 A T 6: 72,826,567 (GRCm39) M1K probably null Het
Letm2 T A 8: 26,071,745 (GRCm39) T386S possibly damaging Het
Lvrn A T 18: 47,014,477 (GRCm39) probably null Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nid2 G A 14: 19,856,006 (GRCm39) D1244N probably damaging Het
Nvl G T 1: 180,921,471 (GRCm39) Q843K probably benign Het
Obi1 T C 14: 104,716,253 (GRCm39) I707V possibly damaging Het
Or1e30 T G 11: 73,678,529 (GRCm39) I255S probably benign Het
Pi4ka A T 16: 17,143,891 (GRCm39) I726N probably damaging Het
Rab25 A T 3: 88,449,567 (GRCm39) C209S probably damaging Het
Rgs6 A T 12: 83,032,150 (GRCm39) I21F probably damaging Het
Rnf10 T C 5: 115,410,426 (GRCm39) D16G probably damaging Het
Rnmt G A 18: 68,439,073 (GRCm39) V61M probably damaging Het
Rrs1 GCTC GC 1: 9,616,328 (GRCm39) probably null Het
Scd4 A T 19: 44,321,931 (GRCm39) M1L possibly damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Sptb A G 12: 76,668,273 (GRCm39) I608T probably damaging Het
Sstr5 A G 17: 25,710,251 (GRCm39) V326A probably benign Het
Sugct T C 13: 17,846,321 (GRCm39) D62G probably damaging Het
Thada C G 17: 84,641,569 (GRCm39) D1306H possibly damaging Het
Thap1 C G 8: 26,652,498 (GRCm39) P79A probably benign Het
Tra2a G A 6: 49,225,969 (GRCm39) S157L probably damaging Het
Trappc10 C T 10: 78,050,520 (GRCm39) R307Q probably damaging Het
Trim9 A G 12: 70,327,467 (GRCm39) I390T possibly damaging Het
Usp24 T C 4: 106,228,230 (GRCm39) V765A probably benign Het
Wdr90 C A 17: 26,078,961 (GRCm39) probably benign Het
Ybey A T 10: 76,304,078 (GRCm39) C41* probably null Het
Other mutations in Efnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Efnb2 APN 8 8,710,589 (GRCm39) missense probably benign 0.08
IGL02076:Efnb2 APN 8 8,710,488 (GRCm39) missense probably benign
IGL03333:Efnb2 APN 8 8,689,275 (GRCm39) nonsense probably null
R1416:Efnb2 UTSW 8 8,672,329 (GRCm39) critical splice donor site probably null
R1760:Efnb2 UTSW 8 8,673,184 (GRCm39) missense possibly damaging 0.90
R1783:Efnb2 UTSW 8 8,673,237 (GRCm39) missense probably damaging 1.00
R4272:Efnb2 UTSW 8 8,670,698 (GRCm39) missense probably damaging 0.99
R4398:Efnb2 UTSW 8 8,670,832 (GRCm39) missense possibly damaging 0.80
R4782:Efnb2 UTSW 8 8,673,104 (GRCm39) splice site probably null
R4799:Efnb2 UTSW 8 8,673,104 (GRCm39) splice site probably null
R5193:Efnb2 UTSW 8 8,673,162 (GRCm39) missense probably damaging 1.00
R5443:Efnb2 UTSW 8 8,670,862 (GRCm39) missense probably damaging 1.00
R5749:Efnb2 UTSW 8 8,689,347 (GRCm39) missense probably damaging 1.00
R6083:Efnb2 UTSW 8 8,672,328 (GRCm39) splice site probably null
R6266:Efnb2 UTSW 8 8,710,524 (GRCm39) missense probably benign
R6482:Efnb2 UTSW 8 8,670,637 (GRCm39) missense probably damaging 1.00
R7371:Efnb2 UTSW 8 8,710,524 (GRCm39) missense probably benign
R8813:Efnb2 UTSW 8 8,670,731 (GRCm39) missense probably damaging 1.00
R9630:Efnb2 UTSW 8 8,670,617 (GRCm39) missense probably damaging 1.00
Z1177:Efnb2 UTSW 8 8,673,147 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTACAGAGTGGCAGCAAAGC -3'
(R):5'- CAGTTACCTACTTGGATTTGCC -3'

Sequencing Primer
(F):5'- AGCAAAGCTGAAATTTCACAAAG -3'
(R):5'- CCTCACACAGGTTGTTGGG -3'
Posted On 2017-01-24