Incidental Mutation 'R4398:Efnb2'
ID325587
Institutional Source Beutler Lab
Gene Symbol Efnb2
Ensembl Gene ENSMUSG00000001300
Gene Nameephrin B2
SynonymsLERK-5, Epl5, Htk-L, ELF-2, NLERK-1, Eplg5, Lerk5
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location8617434-8661242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8620832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 256 (R256H)
Ref Sequence ENSEMBL: ENSMUSP00000001319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001319]
PDB Structure
CRYSTAL STRUCTURE OF THE MURINE EPHRIN-B2 ECTODOMAIN [X-RAY DIFFRACTION]
Crystal Structure of the EphB2-ephrinB2 complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001319
AA Change: R256H

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001319
Gene: ENSMUSG00000001300
AA Change: R256H

DomainStartEndE-ValueType
Pfam:Ephrin 32 167 4.6e-53 PFAM
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152698
AA Change: R139H
SMART Domains Protein: ENSMUSP00000116027
Gene: ENSMUSG00000001300
AA Change: R139H

DomainStartEndE-ValueType
Pfam:Ephrin 1 68 1.3e-19 PFAM
transmembrane domain 115 137 N/A INTRINSIC
low complexity region 151 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208426
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in angiogenesis of both arteries and veins and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Efnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Efnb2 APN 8 8660589 missense probably benign 0.08
IGL02076:Efnb2 APN 8 8660488 missense probably benign
IGL03333:Efnb2 APN 8 8639275 nonsense probably null
IGL03098:Efnb2 UTSW 8 8663420 unclassified probably benign
R1416:Efnb2 UTSW 8 8622329 critical splice donor site probably null
R1760:Efnb2 UTSW 8 8623184 missense possibly damaging 0.90
R1783:Efnb2 UTSW 8 8623237 missense probably damaging 1.00
R4272:Efnb2 UTSW 8 8620698 missense probably damaging 0.99
R4782:Efnb2 UTSW 8 8623104 intron probably null
R4799:Efnb2 UTSW 8 8623104 intron probably null
R5193:Efnb2 UTSW 8 8623162 missense probably damaging 1.00
R5443:Efnb2 UTSW 8 8620862 missense probably damaging 1.00
R5749:Efnb2 UTSW 8 8639347 missense probably damaging 1.00
R6083:Efnb2 UTSW 8 8622328 splice site probably null
R6266:Efnb2 UTSW 8 8660524 missense probably benign
R6482:Efnb2 UTSW 8 8620637 missense probably damaging 1.00
R7371:Efnb2 UTSW 8 8660524 missense probably benign
Z1177:Efnb2 UTSW 8 8623147 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCTGCACGATGTACACC -3'
(R):5'- TCTGCAAGAAACAGGGCAC -3'

Sequencing Primer
(F):5'- ATGTACACCGGGTGCCCATAG -3'
(R):5'- AGGACTCTGGTAACTGGCTC -3'
Posted On2015-07-06