Incidental Mutation 'R5081:Gtf3a'
ID453057
Institutional Source Beutler Lab
Gene Symbol Gtf3a
Ensembl Gene ENSMUSG00000016503
Gene Namegeneral transcription factor III A
Synonyms
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146948657-146955614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146951282 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 131 (V131E)
Ref Sequence ENSEMBL: ENSMUSP00000115824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016654] [ENSMUST00000066675] [ENSMUST00000110564] [ENSMUST00000110566] [ENSMUST00000132102] [ENSMUST00000146511]
Predicted Effect probably benign
Transcript: ENSMUST00000016654
SMART Domains Protein: ENSMUSP00000016654
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066675
SMART Domains Protein: ENSMUSP00000063398
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 73 144 2.1e-13 PFAM
Pfam:IF3_C 153 238 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110564
SMART Domains Protein: ENSMUSP00000106193
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110566
SMART Domains Protein: ENSMUSP00000106195
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132102
AA Change: V131E

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115824
Gene: ENSMUSG00000016503
AA Change: V131E

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133682
Predicted Effect probably benign
Transcript: ENSMUST00000146511
AA Change: V131E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119607
Gene: ENSMUSG00000016503
AA Change: V131E

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
low complexity region 338 361 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Gtf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Gtf3a APN 5 146953953 missense probably damaging 1.00
IGL03404:Gtf3a APN 5 146950639 splice site probably null
R0227:Gtf3a UTSW 5 146955389 missense probably damaging 1.00
R0365:Gtf3a UTSW 5 146948937 missense probably damaging 1.00
R0480:Gtf3a UTSW 5 146953229 missense probably damaging 1.00
R1697:Gtf3a UTSW 5 146951913 missense possibly damaging 0.88
R2171:Gtf3a UTSW 5 146955462 missense probably benign 0.00
R3917:Gtf3a UTSW 5 146955434 missense probably benign 0.26
R4867:Gtf3a UTSW 5 146951913 nonsense probably null
R5268:Gtf3a UTSW 5 146955155 missense probably damaging 1.00
R6056:Gtf3a UTSW 5 146955528 unclassified probably benign
R6376:Gtf3a UTSW 5 146953988 unclassified probably null
R7151:Gtf3a UTSW 5 146951275 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGACTGTGTCACGGAATGG -3'
(R):5'- ACCAACCGGTCACGTGAATG -3'

Sequencing Primer
(F):5'- GCCAGTGCTGTTAACCATTGAAC -3'
(R):5'- GAATGCGCCCTAAGTCAGTTTGC -3'
Posted On2017-01-27