Incidental Mutation 'R5081:Gpcpd1'
ID387111
Institutional Source Beutler Lab
Gene Symbol Gpcpd1
Ensembl Gene ENSMUSG00000027346
Gene Nameglycerophosphocholine phosphodiesterase 1
Synonyms2310004G06Rik, 2310032D16Rik, Prei4
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132529082-132587729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132547702 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 244 (H244Q)
Ref Sequence ENSEMBL: ENSMUSP00000105769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028822] [ENSMUST00000060955] [ENSMUST00000110136] [ENSMUST00000110142] [ENSMUST00000124107] [ENSMUST00000145694] [ENSMUST00000148833] [ENSMUST00000149854]
Predicted Effect probably benign
Transcript: ENSMUST00000028822
AA Change: H60Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028822
Gene: ENSMUSG00000027346
AA Change: H60Q

DomainStartEndE-ValueType
Pfam:GDPD 142 432 1.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060955
AA Change: H244Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000062221
Gene: ENSMUSG00000027346
AA Change: H244Q

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 5.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110136
AA Change: H60Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105763
Gene: ENSMUSG00000027346
AA Change: H60Q

DomainStartEndE-ValueType
Pfam:GDPD 142 431 4.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110142
AA Change: H244Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105769
Gene: ENSMUSG00000027346
AA Change: H244Q

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 6.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124107
SMART Domains Protein: ENSMUSP00000122751
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145694
SMART Domains Protein: ENSMUSP00000116457
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148833
SMART Domains Protein: ENSMUSP00000116156
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 99 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149854
SMART Domains Protein: ENSMUSP00000116949
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 94 5.54e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Gpcpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Gpcpd1 APN 2 132556983 splice site probably null
IGL00672:Gpcpd1 APN 2 132530548 utr 3 prime probably benign
IGL00676:Gpcpd1 APN 2 132554011 missense probably damaging 1.00
IGL00832:Gpcpd1 APN 2 132546850 missense probably damaging 1.00
IGL00931:Gpcpd1 APN 2 132538118 missense probably benign 0.00
IGL01309:Gpcpd1 APN 2 132550324 missense probably damaging 0.97
IGL01960:Gpcpd1 APN 2 132539898 critical splice donor site probably null
IGL02110:Gpcpd1 APN 2 132530610 nonsense probably null
IGL02267:Gpcpd1 APN 2 132568710 missense probably damaging 1.00
IGL02570:Gpcpd1 APN 2 132547685 missense probably benign 0.01
IGL02588:Gpcpd1 APN 2 132534753 missense probably damaging 1.00
IGL03306:Gpcpd1 APN 2 132534073 critical splice donor site probably null
Baependi UTSW 2 132544435 missense probably damaging 1.00
R0413:Gpcpd1 UTSW 2 132564623 splice site probably benign
R1876:Gpcpd1 UTSW 2 132534753 missense probably damaging 1.00
R4276:Gpcpd1 UTSW 2 132540287 missense probably damaging 0.99
R4571:Gpcpd1 UTSW 2 132550350 missense probably benign 0.05
R4849:Gpcpd1 UTSW 2 132534099 missense probably damaging 1.00
R4930:Gpcpd1 UTSW 2 132546874 missense probably damaging 1.00
R5060:Gpcpd1 UTSW 2 132544435 missense probably damaging 1.00
R5148:Gpcpd1 UTSW 2 132534190 nonsense probably null
R5189:Gpcpd1 UTSW 2 132553972 missense probably damaging 1.00
R5344:Gpcpd1 UTSW 2 132558677 intron probably benign
R5623:Gpcpd1 UTSW 2 132534717 missense probably damaging 1.00
R6086:Gpcpd1 UTSW 2 132538114 missense probably damaging 1.00
R6787:Gpcpd1 UTSW 2 132537838 intron probably benign
R6885:Gpcpd1 UTSW 2 132554074 missense possibly damaging 0.56
R7223:Gpcpd1 UTSW 2 132534056 missense probably benign 0.00
R7261:Gpcpd1 UTSW 2 132568699 missense probably damaging 0.97
R7900:Gpcpd1 UTSW 2 132534739 missense probably damaging 0.99
R8120:Gpcpd1 UTSW 2 132554023 missense probably damaging 1.00
R8494:Gpcpd1 UTSW 2 132544435 missense probably damaging 0.97
X0018:Gpcpd1 UTSW 2 132534769 missense probably damaging 1.00
X0060:Gpcpd1 UTSW 2 132534781 missense probably damaging 1.00
X0066:Gpcpd1 UTSW 2 132544395 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TAAGGGCCTAGCTGCTTCTC -3'
(R):5'- CCAAGTTCACTTTGAAGGTTTTAGG -3'

Sequencing Primer
(F):5'- AGCTGCTTCTCCCCAACTTAC -3'
(R):5'- GTCCTCTGACCTCTACATAC -3'
Posted On2016-06-06