Incidental Mutation 'IGL02984:Acvr1b'
ID453284
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Nameactivin A receptor, type 1B
SynonymsActR-IB, ActRIB, Alk4, SKR2, Acvrlk4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02984 (G1)
Quality Score212
Status Validated
Chromosome15
Chromosomal Location101174067-101213684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101203078 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 374 (R374G)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
Predicted Effect probably damaging
Transcript: ENSMUST00000000544
AA Change: R374G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: R374G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Meta Mutation Damage Score 0.7466 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Bglap3 T C 3: 88,368,791 T85A possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Gm14137 G T 2: 119,175,480 E173D probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Sall3 T C 18: 80,973,450 E421G probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Slc35f5 T A 1: 125,562,513 Y71N probably benign Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Usp17le T A 7: 104,769,104 H277L probably benign Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
R1367:Acvr1b UTSW 15 101193938 missense possibly damaging 0.58
R1498:Acvr1b UTSW 15 101194010 missense probably benign
R1591:Acvr1b UTSW 15 101194024 missense probably benign
R1757:Acvr1b UTSW 15 101198822 missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101194025 missense probably benign 0.01
R2223:Acvr1b UTSW 15 101203043 missense probably benign 0.10
R2249:Acvr1b UTSW 15 101203094 missense probably null 1.00
R4674:Acvr1b UTSW 15 101203058 missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101202986 missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101210770 missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101193976 missense probably damaging 1.00
R5397:Acvr1b UTSW 15 101198964 missense probably damaging 0.99
R5574:Acvr1b UTSW 15 101202077 missense probably benign 0.03
R5906:Acvr1b UTSW 15 101193891 intron probably benign
R6025:Acvr1b UTSW 15 101194975 missense probably benign 0.43
R6467:Acvr1b UTSW 15 101194841 missense possibly damaging 0.86
R7158:Acvr1b UTSW 15 101194058 missense probably benign
X0067:Acvr1b UTSW 15 101194022 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCACACATCTTCCTTGAACATG -3'
(R):5'- CAGGGCCACACTTCTATGGAAC -3'

Sequencing Primer
(F):5'- AACATGCCCGGTTTGTGTC -3'
(R):5'- ACACTTCTATGGAACCAGGGCTTG -3'
Posted On2017-02-01