Incidental Mutation 'IGL02984:Usp17le'
ID453270
Institutional Source Beutler Lab
Gene Symbol Usp17le
Ensembl Gene ENSMUSG00000043073
Gene Nameubiquitin specific peptidase 17-like E
SynonymsGm6596, Dub3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #IGL02984 (G1)
Quality Score165
Status Validated
Chromosome7
Chromosomal Location104768049-104777470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104769104 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 277 (H277L)
Ref Sequence ENSEMBL: ENSMUSP00000147776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053464] [ENSMUST00000211384]
Predicted Effect probably benign
Transcript: ENSMUST00000053464
AA Change: H277L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051716
Gene: ENSMUSG00000043073
AA Change: H277L

DomainStartEndE-ValueType
Pfam:UCH 84 379 9e-54 PFAM
Pfam:UCH_1 85 362 2.3e-21 PFAM
low complexity region 408 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211384
AA Change: H277L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.5531 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Bglap3 T C 3: 88,368,791 T85A possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Gm14137 G T 2: 119,175,480 E173D probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Sall3 T C 18: 80,973,450 E421G probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Slc35f5 T A 1: 125,562,513 Y71N probably benign Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Usp17le
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Usp17le APN 7 104768787 missense probably benign 0.00
IGL01974:Usp17le APN 7 104768435 missense probably benign
IGL02364:Usp17le APN 7 104768775 nonsense probably null
IGL02413:Usp17le APN 7 104769726 missense probably benign 0.39
IGL02433:Usp17le APN 7 104769201 missense probably benign 0.01
IGL02960:Usp17le APN 7 104768740 missense probably benign
R0035:Usp17le UTSW 7 104769062 nonsense probably null
R0389:Usp17le UTSW 7 104768460 missense probably damaging 0.96
R0499:Usp17le UTSW 7 104768501 missense probably benign 0.02
R0567:Usp17le UTSW 7 104768898 missense possibly damaging 0.95
R0879:Usp17le UTSW 7 104769647 missense probably damaging 0.99
R0879:Usp17le UTSW 7 104769648 missense possibly damaging 0.46
R4840:Usp17le UTSW 7 104769770 missense probably benign 0.34
R5140:Usp17le UTSW 7 104769438 missense probably damaging 1.00
R5403:Usp17le UTSW 7 104769234 missense probably damaging 1.00
R6210:Usp17le UTSW 7 104769143 missense probably damaging 1.00
R7047:Usp17le UTSW 7 104768433 missense probably benign 0.02
R7157:Usp17le UTSW 7 104768489 missense probably benign 0.03
R7361:Usp17le UTSW 7 104768877 missense probably damaging 1.00
R7386:Usp17le UTSW 7 104768307 splice site probably null
R7997:Usp17le UTSW 7 104768839 missense possibly damaging 0.94
R8189:Usp17le UTSW 7 104769348 missense probably damaging 0.99
R8248:Usp17le UTSW 7 104769794 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCACTGTTAGAAGTCGCACC -3'
(R):5'- CTGGTGGAGGTCTCAGATCAAG -3'

Sequencing Primer
(F):5'- CTGTTAGAAGTCGCACCATCATGG -3'
(R):5'- AGATCAAGTGTCTCCATTGCCAGG -3'
Posted On2017-02-01