Incidental Mutation 'R5854:Ndufs1'
ID454798
Institutional Source Beutler Lab
Gene Symbol Ndufs1
Ensembl Gene ENSMUSG00000025968
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 1
Synonyms9930026A05Rik, 5830412M15Rik
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63143596-63176833 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63147389 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1 (D1E)
Ref Sequence ENSEMBL: ENSMUSP00000140072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027111] [ENSMUST00000168099] [ENSMUST00000185847] [ENSMUST00000187756]
Predicted Effect probably benign
Transcript: ENSMUST00000027111
AA Change: D640E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968
AA Change: D640E

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138611
Predicted Effect probably benign
Transcript: ENSMUST00000168099
AA Change: D640E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968
AA Change: D640E

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186569
Predicted Effect probably benign
Transcript: ENSMUST00000187756
AA Change: D1E

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190095
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 75 kDa subunit family. Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. This protein is the largest subunit of complex I and it is a component of the iron-sulfur (IP) fragment of the enzyme. It may form part of the active site crevice where NADH is oxidized. Mutations in this gene are associated with complex I deficiency. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ndufs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ndufs1 APN 1 63164817 missense probably damaging 0.99
IGL01655:Ndufs1 APN 1 63151557 missense probably damaging 1.00
IGL02532:Ndufs1 APN 1 63170139 missense probably damaging 0.99
IGL02606:Ndufs1 APN 1 63159852 missense probably damaging 1.00
IGL02866:Ndufs1 APN 1 63147141 missense probably benign 0.00
IGL03036:Ndufs1 APN 1 63163696 nonsense probably null
IGL03209:Ndufs1 APN 1 63164737 missense probably damaging 1.00
PIT4142001:Ndufs1 UTSW 1 63159748 unclassified probably benign
R0165:Ndufs1 UTSW 1 63159748 critical splice donor site probably null
R0505:Ndufs1 UTSW 1 63143926 splice site probably benign
R1861:Ndufs1 UTSW 1 63147417 missense probably benign 0.17
R2294:Ndufs1 UTSW 1 63160996 missense probably damaging 1.00
R2872:Ndufs1 UTSW 1 63164723 splice site probably benign
R2873:Ndufs1 UTSW 1 63164723 splice site probably benign
R4092:Ndufs1 UTSW 1 63157246 missense possibly damaging 0.55
R4277:Ndufs1 UTSW 1 63170097 missense possibly damaging 0.84
R4782:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4799:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4993:Ndufs1 UTSW 1 63163776 missense probably benign
R5051:Ndufs1 UTSW 1 63164947 critical splice donor site probably null
R5412:Ndufs1 UTSW 1 63166349 missense possibly damaging 0.79
R5632:Ndufs1 UTSW 1 63150059 missense probably benign 0.00
R5705:Ndufs1 UTSW 1 63147158 missense probably benign 0.05
R5919:Ndufs1 UTSW 1 63143832 makesense probably null
R6598:Ndufs1 UTSW 1 63164950 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTTTACTAGCTGGAAAGAGAG -3'
(R):5'- TGTTGCTGGAGATTGAGCCC -3'

Sequencing Primer
(F):5'- GAGAGACCAGAATCATACTGAAAAC -3'
(R):5'- GTTCTATAGACCAAGCTGGCC -3'
Posted On2017-02-10