Incidental Mutation 'R5886:Pnpla1'
ID456128
Institutional Source Beutler Lab
Gene Symbol Pnpla1
Ensembl Gene ENSMUSG00000043286
Gene Namepatatin-like phospholipase domain containing 1
Synonyms
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28858411-28890308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28876863 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 86 (F86S)
Ref Sequence ENSEMBL: ENSMUSP00000110385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056866] [ENSMUST00000114737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056866
AA Change: F86S

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050123
Gene: ENSMUSG00000043286
AA Change: F86S

DomainStartEndE-ValueType
Pfam:Patatin 16 183 1.4e-14 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114737
AA Change: F86S

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110385
Gene: ENSMUSG00000043286
AA Change: F86S

DomainStartEndE-ValueType
Pfam:Patatin 16 183 9.3e-15 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality; shiny, red, dry, wrinkled and non-elastic skin; reduced size and weight at birth; fail to suckle; and exhibit skin defects associated with a lack of omega-O-acylceramides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hars2 T A 18: 36,790,097 probably benign Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Krt40 C T 11: 99,540,081 A201T probably benign Het
Lca5 G A 9: 83,399,681 A350V probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Tacc2 A G 7: 130,729,120 D378G probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Usp54 C T 14: 20,561,842 D969N probably benign Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Vps39 A G 2: 120,321,572 probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Pnpla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pnpla1 APN 17 28877442 missense probably damaging 1.00
IGL01713:Pnpla1 APN 17 28881605 missense possibly damaging 0.46
IGL02972:Pnpla1 APN 17 28886947 missense probably null 0.65
IGL03350:Pnpla1 APN 17 28876992 missense probably damaging 1.00
R0335:Pnpla1 UTSW 17 28886878 missense possibly damaging 0.48
R1727:Pnpla1 UTSW 17 28878534 missense probably benign 0.30
R3620:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R3621:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R4831:Pnpla1 UTSW 17 28878544 missense probably benign 0.28
R5011:Pnpla1 UTSW 17 28885584 missense possibly damaging 0.57
R5042:Pnpla1 UTSW 17 28881047 missense probably benign
R5068:Pnpla1 UTSW 17 28879423 splice site probably null
R5690:Pnpla1 UTSW 17 28878372 missense probably damaging 1.00
R6269:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6270:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6271:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6272:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6369:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R6611:Pnpla1 UTSW 17 28881047 missense probably benign
R6962:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R7359:Pnpla1 UTSW 17 28881185 missense probably benign 0.25
R7400:Pnpla1 UTSW 17 28858976 missense probably damaging 1.00
R7444:Pnpla1 UTSW 17 28878481 missense possibly damaging 0.95
R7507:Pnpla1 UTSW 17 28876817 missense probably damaging 1.00
R7513:Pnpla1 UTSW 17 28858807 start gained probably benign
X0019:Pnpla1 UTSW 17 28881067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGACATTCTCCTTTATGGCCTG -3'
(R):5'- AGCTCTTCCTTGGATCGGTAC -3'

Sequencing Primer
(F):5'- CAGCTTCTGGGTCTGAGGC -3'
(R):5'- TCCTTGGATCGGTACTCGGAAAC -3'
Posted On2017-02-15