Incidental Mutation 'R5886:Lca5'
ID456098
Institutional Source Beutler Lab
Gene Symbol Lca5
Ensembl Gene ENSMUSG00000032258
Gene NameLeber congenital amaurosis 5 (human)
Synonyms4930431B11Rik, 5730406O13Rik, ORF64
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location83390293-83441127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83399681 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 350 (A350V)
Ref Sequence ENSEMBL: ENSMUSP00000140753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]
Predicted Effect probably benign
Transcript: ENSMUST00000034791
AA Change: A350V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: A350V

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 103 295 2.6e-66 PFAM
low complexity region 306 315 N/A INTRINSIC
low complexity region 617 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034793
AA Change: A350V

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258
AA Change: A350V

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 4.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190514
AA Change: A350V

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258
AA Change: A350V

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 5.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191225
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hars2 T A 18: 36,790,097 probably benign Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Krt40 C T 11: 99,540,081 A201T probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Pnpla1 T C 17: 28,876,863 F86S possibly damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Tacc2 A G 7: 130,729,120 D378G probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Usp54 C T 14: 20,561,842 D969N probably benign Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Vps39 A G 2: 120,321,572 probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Lca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Lca5 APN 9 83395475 missense probably damaging 0.98
IGL01349:Lca5 APN 9 83426617 missense probably damaging 1.00
IGL01918:Lca5 APN 9 83423148 missense probably damaging 1.00
IGL02035:Lca5 APN 9 83423312 missense probably damaging 1.00
IGL02276:Lca5 APN 9 83398585 missense possibly damaging 0.79
IGL02425:Lca5 APN 9 83399721 missense probably damaging 1.00
IGL02481:Lca5 APN 9 83423117 missense probably damaging 1.00
IGL02483:Lca5 APN 9 83423117 missense probably damaging 1.00
R0465:Lca5 UTSW 9 83395867 nonsense probably null
R0610:Lca5 UTSW 9 83399739 missense probably benign 0.24
R0811:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0812:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0968:Lca5 UTSW 9 83423169 missense probably benign 0.01
R1891:Lca5 UTSW 9 83395608 missense probably damaging 1.00
R5223:Lca5 UTSW 9 83398613 missense probably benign 0.00
R5235:Lca5 UTSW 9 83423054 nonsense probably null
R5260:Lca5 UTSW 9 83423223 missense probably damaging 0.98
R5531:Lca5 UTSW 9 83398595 missense probably benign 0.00
R5558:Lca5 UTSW 9 83401743 missense probably damaging 0.99
R5688:Lca5 UTSW 9 83398566 missense probably benign 0.01
R6426:Lca5 UTSW 9 83395654 nonsense probably null
R7108:Lca5 UTSW 9 83423169 missense probably benign 0.25
R7151:Lca5 UTSW 9 83398640 missense probably benign 0.20
R7314:Lca5 UTSW 9 83395510 missense possibly damaging 0.86
R7378:Lca5 UTSW 9 83395530 missense probably benign 0.00
R7468:Lca5 UTSW 9 83423456 missense probably damaging 0.99
R7686:Lca5 UTSW 9 83395239 missense probably benign 0.00
R8874:Lca5 UTSW 9 83395450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTATAAACTGACTCACTAGCCC -3'
(R):5'- AAATGTGTGCTCCCGTTGGG -3'

Sequencing Primer
(F):5'- GCACATCTGAATGTATCCCTGAGG -3'
(R):5'- GATGAGTGTTGCCGATTGAATGTAC -3'
Posted On2017-02-15