Incidental Mutation 'R5890:Gamt'
ID457105
Institutional Source Beutler Lab
Gene Symbol Gamt
Ensembl Gene ENSMUSG00000020150
Gene Nameguanidinoacetate methyltransferase
SynonymsSpintz1
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80258151-80261012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80259907 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 63 (R63L)
Ref Sequence ENSEMBL: ENSMUSP00000101002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020359] [ENSMUST00000020361] [ENSMUST00000105363] [ENSMUST00000105364] [ENSMUST00000156935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020359
AA Change: R63L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020359
Gene: ENSMUSG00000020150
AA Change: R63L

DomainStartEndE-ValueType
PDB:1XCL|A 2 252 1e-151 PDB
SCOP:d1khha_ 44 252 3e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020361
SMART Domains Protein: ENSMUSP00000020361
Gene: ENSMUSG00000020153

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105363
AA Change: R63L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101002
Gene: ENSMUSG00000020150
AA Change: R63L

DomainStartEndE-ValueType
PDB:1XCL|A 2 236 1e-155 PDB
SCOP:d1khha_ 44 236 2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105364
SMART Domains Protein: ENSMUSP00000101003
Gene: ENSMUSG00000020153

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155336
Predicted Effect probably benign
Transcript: ENSMUST00000156935
SMART Domains Protein: ENSMUSP00000117497
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 3 75 1.89e-24 SMART
RRM 105 171 6.71e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157063
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display increased postnatal lethality; reduced body weight, muscle tension, and creatine concentrations; infertility with impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Gamt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Gamt APN 10 80258396 missense possibly damaging 0.89
IGL03115:Gamt APN 10 80258438 missense probably damaging 1.00
mr_bigger UTSW 10 80260724 nonsense probably null
R0001:Gamt UTSW 10 80259061 unclassified probably benign
R1471:Gamt UTSW 10 80260858 missense probably benign 0.37
R4156:Gamt UTSW 10 80260724 nonsense probably null
R5049:Gamt UTSW 10 80258954 missense probably benign
R7910:Gamt UTSW 10 80258409 missense possibly damaging 0.95
R7991:Gamt UTSW 10 80258409 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCCTTTCAAGGGAACAACC -3'
(R):5'- TAGAGCACAAATCGCGTGGG -3'

Sequencing Primer
(F):5'- TTGAGGGTCACATGGGACC -3'
(R):5'- TAGCCGCTCTGATTGGCAG -3'
Posted On2017-02-15