Incidental Mutation 'R5926:Cyb5r4'
ID459902
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Namecytochrome b5 reductase 4
Synonymsb5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
MMRRC Submission 044121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5926 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location87022014-87077774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87057261 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 366 (L366F)
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529] [ENSMUST00000174294]
Predicted Effect probably benign
Transcript: ENSMUST00000168529
AA Change: L366F

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872
AA Change: L366F

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174043
Predicted Effect probably benign
Transcript: ENSMUST00000174294
SMART Domains Protein: ENSMUSP00000133918
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
Pfam:NAD_binding_6 16 89 8.7e-8 PFAM
Pfam:NAD_binding_1 21 88 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174724
SMART Domains Protein: ENSMUSP00000133556
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.2e-16 PFAM
Pfam:FAD_binding_6 284 391 1.7e-22 PFAM
Pfam:NAD_binding_1 402 509 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,560,645 Y701F probably benign Het
Abra T A 15: 41,866,254 H250L probably damaging Het
Acer2 T C 4: 86,874,568 V27A probably benign Het
Arhgef15 A G 11: 68,951,955 L343S possibly damaging Het
Arnt2 G T 7: 84,343,946 H129N probably damaging Het
Atp9a T A 2: 168,706,271 Y63F probably damaging Het
Brca2 A G 5: 150,534,622 T213A probably benign Het
Cdk5r1 T C 11: 80,478,302 probably null Het
Cyp20a1 T A 1: 60,363,242 I162K possibly damaging Het
Dcaf1 T C 9: 106,838,362 V226A probably benign Het
Ddx41 A T 13: 55,534,299 M232K probably damaging Het
Dnm1 C T 2: 32,315,804 V99I probably benign Het
Doc2a T C 7: 126,849,525 V134A probably damaging Het
Ghdc C T 11: 100,768,237 V380M possibly damaging Het
Gldn A G 9: 54,338,438 I424M possibly damaging Het
Haus6 A T 4: 86,599,316 H270Q probably benign Het
Hfe A T 13: 23,708,264 M39K probably damaging Het
Jakmip1 C T 5: 37,085,280 probably benign Het
Kcnb2 A G 1: 15,313,011 N187S probably benign Het
Kcnd2 A G 6: 21,217,085 S263G probably damaging Het
Kcnh1 A G 1: 192,413,077 N481S probably benign Het
Kcnn2 A G 18: 45,685,284 I343V probably benign Het
L3hypdh T A 12: 72,077,185 S300C probably damaging Het
Lrit1 T A 14: 37,055,009 C29S probably damaging Het
Mark3 T A 12: 111,592,734 V70E probably damaging Het
Med16 C T 10: 79,902,528 V319M probably damaging Het
Mindy3 T C 2: 12,348,100 Y430C probably damaging Het
Mup5 A T 4: 61,833,049 F121I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Notch1 A G 2: 26,476,104 Y813H probably benign Het
Olfr1415 A T 1: 92,491,566 L63Q probably damaging Het
Olfr473 T C 7: 107,933,903 S128P probably damaging Het
Olfr512 T C 7: 108,713,587 L66S probably damaging Het
Pi4kb A G 3: 94,998,996 Y301C probably damaging Het
Ptch1 A G 13: 63,545,055 S244P probably benign Het
Ptprn G A 1: 75,254,598 T554I probably damaging Het
Ptprt T C 2: 161,564,686 I969V probably benign Het
Raf1 T C 6: 115,619,898 M519V probably benign Het
Ryr1 A G 7: 29,104,360 V622A probably damaging Het
Spaca4 G T 7: 45,725,295 H94Q probably benign Het
Spata31 A G 13: 64,920,725 D229G possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Trpm8 T A 1: 88,330,747 Y251N probably damaging Het
Vps16 T A 2: 130,443,556 N806K probably damaging Het
Vwf T C 6: 125,604,174 F592L probably damaging Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCACACACTGATGGCATCC -3'
(R):5'- CAGGGAATGAGCAAGTGTCC -3'

Sequencing Primer
(F):5'- CACACTGATGGCATCCTAAGATTTG -3'
(R):5'- TGTCCAGAGAAGGGCACAGATG -3'
Posted On2017-02-28