Incidental Mutation 'R5973:Sipa1l3'
ID471544
Institutional Source Beutler Lab
Gene Symbol Sipa1l3
Ensembl Gene ENSMUSG00000030583
Gene Namesignal-induced proliferation-associated 1 like 3
Synonyms2610511M17Rik
MMRRC Submission 044156-MU
Accession Numbers

NCBI RefSeq: NM_001081028.1; MGI: 1921456

Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R5973 (G1)
Quality Score174
Status Not validated
Chromosome7
Chromosomal Location29320372-29518641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29399524 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 440 (A440V)
Ref Sequence ENSEMBL: ENSMUSP00000138171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085809] [ENSMUST00000181975] [ENSMUST00000183096]
Predicted Effect probably benign
Transcript: ENSMUST00000085809
AA Change: A440V

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583
AA Change: A440V

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182702
Predicted Effect probably benign
Transcript: ENSMUST00000183096
AA Change: A440V

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583
AA Change: A440V

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the signal induced proliferation associated 1 family of genes, which encode GTPase-activating proteins specific for the GTP-binding protein Rap1. Rap1 has been implicated in regulation of cell adhesion, cell polarity, and organization of the cytoskeleton. Like other members of the family, the protein encoded by this gene contains RapGAP and PDZ domains. In addition, this protein contains a C-terminal leucine zipper domain. This gene is proposed to function in epithelial cell morphogenesis and establishment or maintenance of polarity. Consistently, expression of the protein in cell culture showed localization to cell-cell borders in apical regions, and downregulation of the gene in 3D Caco2 cell culture resulted in abnormal cell polarity and morphogenesis. Allelic variants of this gene have been associated with congenital cataracts in humans. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small lenses, microphthalmia, cataracts, posterior iris synechia, and abnormal lens fiber morphology. [provided by MGI curators]
Allele List at MGI

All alleles(486) : Gene trapped(486)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Sipa1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Sipa1l3 APN 7 29354133 missense probably damaging 0.97
IGL00481:Sipa1l3 APN 7 29386108 missense probably damaging 0.99
IGL01071:Sipa1l3 APN 7 29324220 missense possibly damaging 0.88
IGL01300:Sipa1l3 APN 7 29399828 nonsense probably null
IGL01361:Sipa1l3 APN 7 29348687 missense probably damaging 1.00
IGL01380:Sipa1l3 APN 7 29331372 missense possibly damaging 0.94
IGL02083:Sipa1l3 APN 7 29387261 missense probably damaging 1.00
IGL02484:Sipa1l3 APN 7 29399531 missense probably damaging 1.00
IGL02542:Sipa1l3 APN 7 29388065 missense probably damaging 1.00
IGL02645:Sipa1l3 APN 7 29328980 splice site probably null
IGL03410:Sipa1l3 APN 7 29348539 missense probably damaging 1.00
P0014:Sipa1l3 UTSW 7 29383215 missense probably damaging 1.00
R0111:Sipa1l3 UTSW 7 29348318 missense probably damaging 0.99
R0309:Sipa1l3 UTSW 7 29348350 missense probably benign 0.01
R0554:Sipa1l3 UTSW 7 29388030 missense possibly damaging 0.90
R0624:Sipa1l3 UTSW 7 29387251 missense probably damaging 1.00
R0894:Sipa1l3 UTSW 7 29387291 nonsense probably null
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1550:Sipa1l3 UTSW 7 29383203 missense probably benign 0.00
R1850:Sipa1l3 UTSW 7 29339126 missense probably damaging 0.96
R1905:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1907:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1994:Sipa1l3 UTSW 7 29399611 missense probably benign 0.39
R2228:Sipa1l3 UTSW 7 29377939 nonsense probably null
R2267:Sipa1l3 UTSW 7 29399602 missense probably damaging 1.00
R2341:Sipa1l3 UTSW 7 29377635 missense probably damaging 0.98
R3914:Sipa1l3 UTSW 7 29400085 missense probably benign 0.28
R4197:Sipa1l3 UTSW 7 29400813 missense possibly damaging 0.81
R4559:Sipa1l3 UTSW 7 29332253 missense probably damaging 1.00
R4569:Sipa1l3 UTSW 7 29325862 missense probably damaging 1.00
R4783:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4784:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4785:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4823:Sipa1l3 UTSW 7 29371002 missense probably damaging 1.00
R5057:Sipa1l3 UTSW 7 29371193 missense probably damaging 1.00
R5084:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5085:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5086:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5918:Sipa1l3 UTSW 7 29397206 missense probably damaging 1.00
R6291:Sipa1l3 UTSW 7 29388133 missense probably damaging 1.00
R6299:Sipa1l3 UTSW 7 29366549 critical splice donor site probably null
R6828:Sipa1l3 UTSW 7 29339032 missense probably benign 0.17
R6914:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R6942:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R7102:Sipa1l3 UTSW 7 29348587 missense possibly damaging 0.74
R7225:Sipa1l3 UTSW 7 29399428 missense probably damaging 1.00
R7310:Sipa1l3 UTSW 7 29399696 missense probably benign
R7429:Sipa1l3 UTSW 7 29387206 missense probably benign 0.24
R7489:Sipa1l3 UTSW 7 29366702 missense probably damaging 1.00
R7789:Sipa1l3 UTSW 7 29377725 missense probably damaging 1.00
R7923:Sipa1l3 UTSW 7 29339146 nonsense probably null
R8041:Sipa1l3 UTSW 7 29364220 missense probably damaging 1.00
R8245:Sipa1l3 UTSW 7 29400364 missense probably damaging 1.00
Z1177:Sipa1l3 UTSW 7 29400434 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGTCCTGGTAGTAGCGAGC -3'
(R):5'- AGCATGCTGTTTGACCTCAACG -3'

Sequencing Primer
(F):5'- TAGTAGCGAGCGCCCAG -3'
(R):5'- AGCTGCCAACAGGGTGTC -3'
Posted On2017-03-31