Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Sipa1l3'

562092

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l3

Ensembl Gene

ENSMUSG00000030583

Gene Name

signal-induced proliferation-associated 1 like 3

Synonyms

2610511M17Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001081028.1; MGI: 1921456

Is this an essential gene?

Possibly essential (E-score: 0.562) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29320372-29518641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 29399428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 472 (V472G)

Ref Sequence

ENSEMBL: ENSMUSP00000082965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085809] [ENSMUST00000181975] [ENSMUST00000183096]

AlphaFold

G3X9J0

Predicted Effect

probably damaging
Transcript: ENSMUST00000085809
AA Change: V472G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583
AA Change: V472G

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	361	380	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
Pfam:Rap_GAP	634	816	1.7e-68	PFAM
PDZ	969	1035	1.39e-8	SMART
low complexity region	1053	1064	N/A	INTRINSIC
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1260	1277	N/A	INTRINSIC
low complexity region	1283	1294	N/A	INTRINSIC
Pfam:SPAR_C	1471	1721	1.6e-96	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000181975

Predicted Effect

probably damaging
Transcript: ENSMUST00000183096
AA Change: V472G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583
AA Change: V472G

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	361	380	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
Pfam:Rap_GAP	634	822	6.7e-64	PFAM
PDZ	969	1035	1.39e-8	SMART
low complexity region	1053	1064	N/A	INTRINSIC
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1260	1277	N/A	INTRINSIC
low complexity region	1283	1294	N/A	INTRINSIC
Pfam:DUF3401	1471	1721	7.2e-94	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the signal induced proliferation associated 1 family of genes, which encode GTPase-activating proteins specific for the GTP-binding protein Rap1. Rap1 has been implicated in regulation of cell adhesion, cell polarity, and organization of the cytoskeleton. Like other members of the family, the protein encoded by this gene contains RapGAP and PDZ domains. In addition, this protein contains a C-terminal leucine zipper domain. This gene is proposed to function in epithelial cell morphogenesis and establishment or maintenance of polarity. Consistently, expression of the protein in cell culture showed localization to cell-cell borders in apical regions, and downregulation of the gene in 3D Caco2 cell culture resulted in abnormal cell polarity and morphogenesis. Allelic variants of this gene have been associated with congenital cataracts in humans. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small lenses, microphthalmia, cataracts, posterior iris synechia, and abnormal lens fiber morphology. [provided by MGI curators]

Allele List at MGI

All alleles(486) : Gene trapped(486)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Sipa1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Sipa1l3	APN	7	29354133	missense	probably damaging	0.97
IGL00481:Sipa1l3	APN	7	29386108	missense	probably damaging	0.99
IGL01071:Sipa1l3	APN	7	29324220	missense	possibly damaging	0.88
IGL01300:Sipa1l3	APN	7	29399828	nonsense	probably null
IGL01361:Sipa1l3	APN	7	29348687	missense	probably damaging	1.00
IGL01380:Sipa1l3	APN	7	29331372	missense	possibly damaging	0.94
IGL02083:Sipa1l3	APN	7	29387261	missense	probably damaging	1.00
IGL02484:Sipa1l3	APN	7	29399531	missense	probably damaging	1.00
IGL02542:Sipa1l3	APN	7	29388065	missense	probably damaging	1.00
IGL02645:Sipa1l3	APN	7	29328980	splice site	probably null
IGL03410:Sipa1l3	APN	7	29348539	missense	probably damaging	1.00
P0014:Sipa1l3	UTSW	7	29383215	missense	probably damaging	1.00
R0111:Sipa1l3	UTSW	7	29348318	missense	probably damaging	0.99
R0309:Sipa1l3	UTSW	7	29348350	missense	probably benign	0.01
R0554:Sipa1l3	UTSW	7	29388030	missense	possibly damaging	0.90
R0624:Sipa1l3	UTSW	7	29387251	missense	probably damaging	1.00
R0894:Sipa1l3	UTSW	7	29387291	nonsense	probably null
R1468:Sipa1l3	UTSW	7	29322260	missense	possibly damaging	0.87
R1468:Sipa1l3	UTSW	7	29322260	missense	possibly damaging	0.87
R1550:Sipa1l3	UTSW	7	29383203	missense	probably benign	0.00
R1850:Sipa1l3	UTSW	7	29339126	missense	probably damaging	0.96
R1905:Sipa1l3	UTSW	7	29339167	missense	possibly damaging	0.89
R1907:Sipa1l3	UTSW	7	29339167	missense	possibly damaging	0.89
R1994:Sipa1l3	UTSW	7	29399611	missense	probably benign	0.39
R2228:Sipa1l3	UTSW	7	29377939	nonsense	probably null
R2267:Sipa1l3	UTSW	7	29399602	missense	probably damaging	1.00
R2341:Sipa1l3	UTSW	7	29377635	missense	probably damaging	0.98
R3914:Sipa1l3	UTSW	7	29400085	missense	probably benign	0.28
R4197:Sipa1l3	UTSW	7	29400813	missense	possibly damaging	0.81
R4559:Sipa1l3	UTSW	7	29332253	missense	probably damaging	1.00
R4569:Sipa1l3	UTSW	7	29325862	missense	probably damaging	1.00
R4783:Sipa1l3	UTSW	7	29377641	missense	probably damaging	1.00
R4784:Sipa1l3	UTSW	7	29377641	missense	probably damaging	1.00
R4785:Sipa1l3	UTSW	7	29377641	missense	probably damaging	1.00
R4823:Sipa1l3	UTSW	7	29371002	missense	probably damaging	1.00
R5057:Sipa1l3	UTSW	7	29371193	missense	probably damaging	1.00
R5084:Sipa1l3	UTSW	7	29348575	missense	probably damaging	1.00
R5085:Sipa1l3	UTSW	7	29348575	missense	probably damaging	1.00
R5086:Sipa1l3	UTSW	7	29348575	missense	probably damaging	1.00
R5918:Sipa1l3	UTSW	7	29397206	missense	probably damaging	1.00
R5973:Sipa1l3	UTSW	7	29399524	missense	probably benign	0.20
R6291:Sipa1l3	UTSW	7	29388133	missense	probably damaging	1.00
R6299:Sipa1l3	UTSW	7	29366549	critical splice donor site	probably null
R6828:Sipa1l3	UTSW	7	29339032	missense	probably benign	0.17
R6914:Sipa1l3	UTSW	7	29386091	missense	probably damaging	1.00
R6942:Sipa1l3	UTSW	7	29386091	missense	probably damaging	1.00
R7102:Sipa1l3	UTSW	7	29348587	missense	possibly damaging	0.74
R7310:Sipa1l3	UTSW	7	29399696	missense	probably benign
R7429:Sipa1l3	UTSW	7	29387206	missense	probably benign	0.24
R7489:Sipa1l3	UTSW	7	29366702	missense	probably damaging	1.00
R7789:Sipa1l3	UTSW	7	29377725	missense	probably damaging	1.00
R7923:Sipa1l3	UTSW	7	29339146	nonsense	probably null
R8041:Sipa1l3	UTSW	7	29364220	missense	probably damaging	1.00
R8245:Sipa1l3	UTSW	7	29400364	missense	probably damaging	1.00
R9125:Sipa1l3	UTSW	7	29387231	missense	probably damaging	0.98
R9313:Sipa1l3	UTSW	7	29378014	missense	probably benign	0.38
Z1177:Sipa1l3	UTSW	7	29400434	missense	probably benign	0.06
Z1186:Sipa1l3	UTSW	7	29331947	critical splice donor site	probably null
Z1186:Sipa1l3	UTSW	7	29332211	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCAGGTTGTAGCTTCCTC -3'
(R):5'- GACGACAATAGCAATGACCTG -3'

Sequencing Primer
(F):5'- CCAGGCACCTCTAGTAATGAGATG -3'
(R):5'- GCTACTTAGCTGCCCGCAC -3'

Posted On

2019-06-26