Incidental Mutation 'R0507:Mbd6'
ID47679
Institutional Source Beutler Lab
Gene Symbol Mbd6
Ensembl Gene ENSMUSG00000025409
Gene Namemethyl-CpG binding domain protein 6
SynonymsD10Wsu93e
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127281956-127289018 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 127283520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078] [ENSMUST00000156208] [ENSMUST00000172567]
Predicted Effect probably benign
Transcript: ENSMUST00000026476
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026479
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119078
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126243
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156208
SMART Domains Protein: ENSMUSP00000114590
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
SCOP:d1qk9a_ 22 88 6e-5 SMART
Blast:MBD 26 79 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172567
SMART Domains Protein: ENSMUSP00000134527
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 66 N/A INTRINSIC
low complexity region 81 115 N/A INTRINSIC
low complexity region 119 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Cx3cr1 C A 9: 120,051,956 D127Y probably damaging Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1500 T A 19: 13,827,776 I207F possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Ppp1r13l T C 7: 19,375,814 L720P possibly damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Thsd1 T A 8: 22,258,679 I461N probably damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Zfp512b C A 2: 181,584,964 probably benign Het
Other mutations in Mbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Mbd6 APN 10 127284119 unclassified probably benign
IGL01685:Mbd6 APN 10 127284732 unclassified probably benign
IGL02741:Mbd6 APN 10 127287394 critical splice donor site probably null
IGL03090:Mbd6 APN 10 127287144 missense probably damaging 1.00
IGL03395:Mbd6 APN 10 127283417 missense probably damaging 1.00
R0041:Mbd6 UTSW 10 127286872 missense probably damaging 1.00
R0480:Mbd6 UTSW 10 127285873 unclassified probably benign
R1686:Mbd6 UTSW 10 127287417 missense probably damaging 0.99
R3418:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3419:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3724:Mbd6 UTSW 10 127283891 unclassified probably benign
R3731:Mbd6 UTSW 10 127285768 unclassified probably benign
R3742:Mbd6 UTSW 10 127284943 unclassified probably benign
R3800:Mbd6 UTSW 10 127285167 unclassified probably benign
R5023:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5024:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5053:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5056:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5568:Mbd6 UTSW 10 127283428 missense possibly damaging 0.82
R5656:Mbd6 UTSW 10 127285286 unclassified probably benign
R7607:Mbd6 UTSW 10 127285230 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCAACAAATAGGTGGCGCAG -3'
(R):5'- GACTTAGGGGCATTAACGGTGAGAC -3'

Sequencing Primer
(F):5'- caggGTGGGCCTCACAC -3'
(R):5'- CATTAACGGTGAGACCAGGC -3'
Posted On2013-06-12